Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31395

Rpl38 ( MGI:1914921)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31395 EMAGE:31395 EMAGE:31395 EMAGE:31395 EMAGE:31395
euxassay_002056_01 euxassay_002056_02 euxassay_002056_03 euxassay_002056_04 euxassay_002056_05
EMAGE:31395 EMAGE:31395 EMAGE:31395 EMAGE:31395 EMAGE:31395
euxassay_002056_06 euxassay_002056_07 euxassay_002056_08 euxassay_002056_09 euxassay_002056_10
EMAGE:31395 EMAGE:31395 EMAGE:31395 EMAGE:31395 EMAGE:31395
euxassay_002056_11 euxassay_002056_12 euxassay_002056_13 euxassay_002056_14 euxassay_002056_15
EMAGE:31395 EMAGE:31395 EMAGE:31395 EMAGE:31395 EMAGE:31395
euxassay_002056_16 euxassay_002056_17 euxassay_002056_18 euxassay_002056_19 euxassay_002056_20
EMAGE:31395 EMAGE:31395 EMAGE:31395 EMAGE:31395
euxassay_002056_21 euxassay_002056_22 euxassay_002056_23 euxassay_002056_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
homogeneousstrong expression: see section 09 10 11 13 moderate expression: see section 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4621
Entity Detected:Rpl38, ( MGI:1914921)
Sequence:sense strand is shown

>T4621
CTCTTCGGTTCTCATCGCTGTGCGGACGCCAGAGCCGAGCCCGCGTCGCCATGCCTCGGAAAATTGAGGA
GATCAAGGACTTTCTGCTGACAGCCCGGCGGAAGGATGCCAAGTCTGTCAAGATCAAGAAGAACAAGGAT
AATGTGAAGTTCAAGGTTCGCTGCAGCAGGTACCTTTACACCCTGGTTATCACAGACAAGGAAAAGGCAG
AGAAGCTGAAGCAGTCCCTACCCCCGGGTTTGGCAGTGAAGGATCTGAAATGAACCAGCCCTCTGCGTGT
GACTATTAAAAACCCTGAAAAGTGAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:5003663 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:5003663 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002056 same experiment
 EMAGE:29250 same embryo
 EMAGE:30939 same embryo
 EMAGE:31393 same embryo
 EMAGE:31376 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS