Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31426

Gtf2h5 general transcription factor IIH, polypeptide 5 ( MGI:107227)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31426 EMAGE:31426 EMAGE:31426 EMAGE:31426 EMAGE:31426
euxassay_003129_01 euxassay_003129_02 euxassay_003129_03 euxassay_003129_04 euxassay_003129_05
EMAGE:31426 EMAGE:31426 EMAGE:31426 EMAGE:31426 EMAGE:31426
euxassay_003129_06 euxassay_003129_07 euxassay_003129_08 euxassay_003129_09 euxassay_003129_10
EMAGE:31426 EMAGE:31426 EMAGE:31426 EMAGE:31426 EMAGE:31426
euxassay_003129_11 euxassay_003129_12 euxassay_003129_13 euxassay_003129_14 euxassay_003129_15
EMAGE:31426 EMAGE:31426 EMAGE:31426 EMAGE:31426 EMAGE:31426
euxassay_003129_16 euxassay_003129_17 euxassay_003129_18 euxassay_003129_19 euxassay_003129_20
EMAGE:31426 EMAGE:31426 EMAGE:31426 EMAGE:31426
euxassay_003129_21 euxassay_003129_22 euxassay_003129_23 euxassay_003129_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 12 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19 20
thoracic ganglion
weak weak
regionalweak expression: see section 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 18 19 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 22 23
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 21 22 23 24
vibrissa
moderate moderate
regionalmoderate expression: see section 07 08 09 weak expression: see section 22 23
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 12 13 17 18 19 20
cervical ganglion
weak weak
regionalweak expression: see section 10 18
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16 17 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 14 16 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4205
Entity Detected:Gtf2h5, general transcription factor IIH, polypeptide 5 ( MGI:107227)
Sequence:sense strand is shown

>T4205
CCGGGCCAGCTCTGGTTTGTTGGAGTTGGAACGCTGCTGCCTCTGCGCGCCTAGAAAAAGAATTCTTGAA
GTCATCTGCACCGTCTGCCTGGGAAAAGATGGTCAACGTGCTGAAAGGGGTGCTTATAGAATGTGACCCT
GCCATGAAGCAGTTCTTGCTGTACTTGGATGAGGCCAACGCCTTGGGGAAGAAGTTCATCATTCAGGACA
TTGATGACACGCACGTCTTCGTCATTGCCGAGCTGGTCAACGTCCTCCAGGAGCGAGTAGGGGAACTGAT
GGACCAGAATGCCTTTTCTCTTACCCAGAAGTGAGAGCGCTGGTGTTGAGCACTTGGGAATCCCAGCCAC
AGACACTTGAGAGAGGCCAGCTCAGTGTCTCGTGGGGTTTATACTTGTTATGAGCATGTCGTGGGAAAGG
CTGCAGGGTCATTCATTCAGATGAAAGCCCCTAACTGATTTGGTTGGACCATTAAAAAAAAAATATGTGT
ACAGAAGAACTTTAGCTGCAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:4489531 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:4489531 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_003129 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS