Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31442

Zfp451 zinc finger protein 451 ( MGI:2137896)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31442 EMAGE:31442 EMAGE:31442 EMAGE:31442 EMAGE:31442
euxassay_000068_01 euxassay_000068_02 euxassay_000068_03 euxassay_000068_04 euxassay_000068_05
EMAGE:31442 EMAGE:31442 EMAGE:31442 EMAGE:31442 EMAGE:31442
euxassay_000068_06 euxassay_000068_07 euxassay_000068_08 euxassay_000068_09 euxassay_000068_10
EMAGE:31442 EMAGE:31442 EMAGE:31442 EMAGE:31442 EMAGE:31442
euxassay_000068_11 euxassay_000068_12 euxassay_000068_13 euxassay_000068_14 euxassay_000068_15
EMAGE:31442 EMAGE:31442 EMAGE:31442 EMAGE:31442 EMAGE:31442
euxassay_000068_16 euxassay_000068_17 euxassay_000068_18 euxassay_000068_19 euxassay_000068_20
EMAGE:31442 EMAGE:31442 EMAGE:31442 EMAGE:31442
euxassay_000068_21 euxassay_000068_22 euxassay_000068_23 euxassay_000068_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cerebral cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 24 weak expression: see section 03 04 05 06 07 08 21 22 23
physiological umbilical hernia
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 06 07
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 10 13 15 16 20 weak expression: see section 09 11 12 17 18 19
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16 weak expression: see section 11 12 17 18 19
metanephros
weak weak
homogeneousweak expression: see section 08 09 10 11 18 19 20 21 22 23
testis
strong strong
spottedstrong expression: see section 07 08 moderate expression: see section 06 23 24
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1570
Entity Detected:Zfp451, zinc finger protein 451 ( MGI:2137896)
Sequence:sense strand is shown

>T1570
AGAAAAGTGAGGAGGAGCAGCAGTATGTGATCAAGTGTGGCATCTGCACCAAGGCATTCCAGAACACGGA
GAGCGCTCAGCAGCACTTCCACAGGAAGCACGCGGCCCTCCAGAAACCCACCGCGACCCCAGGGGGAGCC
AACAGAAGCAGCACATGCCAGCTGGCTGCTAGTGCCTCACATGCTGAGAAAAACCTGAAACAGCCTAGCT
CTCAGAAACATTCAGACGTGGAAAAAGGAGCTGAGCATGATGTACGCTGCCAGAACATAGAGGAGGAAGT
TGAGCTTCCGGATGTGGACTACCTGCGGACCATGACTCACATAGTCTTTGTAGATTTTGATAACTGGTCC
AACTTTTTTGGTCATCTACCTGGGCATCTTAATCAAGGAACGTTTATTTGGGGCTTTCAAGGGGGAAACA
CCAACTGGAAGCCCCCGCTCAGCTGTAAGGTCTATAATTACTTGAGCAGGATTGGCTGCTTCTTCCTTCA
TCCTCGCTGCAGTAAAAGAAAAGATGCCGCGGATTTTGCCATATGTA
Notes:The probe template was PCR amplified from IMAGE:933209 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:933209 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000068 same experiment
 EMAGE:30393 same embryo
 EMAGE:32028 same embryo
 EMAGE:30632 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS