Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31443

Zfp750 zinc finger protein 750 ( MGI:2442210)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31443 EMAGE:31443 EMAGE:31443 EMAGE:31443 EMAGE:31443
euxassay_000069_01 euxassay_000069_02 euxassay_000069_03 euxassay_000069_04 euxassay_000069_05
EMAGE:31443 EMAGE:31443 EMAGE:31443 EMAGE:31443 EMAGE:31443
euxassay_000069_06 euxassay_000069_07 euxassay_000069_08 euxassay_000069_09 euxassay_000069_10
EMAGE:31443 EMAGE:31443 EMAGE:31443 EMAGE:31443 EMAGE:31443
euxassay_000069_11 euxassay_000069_12 euxassay_000069_13 euxassay_000069_14 euxassay_000069_15
EMAGE:31443 EMAGE:31443 EMAGE:31443 EMAGE:31443 EMAGE:31443
euxassay_000069_16 euxassay_000069_17 euxassay_000069_18 euxassay_000069_19 euxassay_000069_20
EMAGE:31443 EMAGE:31443 EMAGE:31443
euxassay_000069_21 euxassay_000069_22 euxassay_000069_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
oral epithelium
strong strong
homogeneousstrong expression: see section 02 05 08 09 10 11 13 14 15 21 22 moderate expression: see section 16
vestibulocochlear viii ganglion
weak weak
homogeneousweak expression: see section 01 10 11 12 13
glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 22 weak expression: see section 03 11 21
oral cavity
strong strong
homogeneousstrong expression: see section 06 moderate expression: see section 20
dorsal root ganglion
moderate moderate
homogeneousmoderate expression: see section 15 weak expression: see section 01 02 05 08 09 10 14 16
esophagus
strong strong
homogeneousstrong expression: see section 06
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 22 weak expression: see section 01 02 03 11 20 21
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 13 weak expression: see section 12
vagus x ganglion
weak weak
homogeneousweak expression: see section 01 02 10 12 13 14
thymus primordium
moderate moderate
regionalmoderate expression: see section 05 06 08 16 weak expression: see section 07
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 19 22 weak expression: see section 01 02 03 04 09 10 11 12 13 20 21
vibrissa
strong strong
regionalstrong expression: see section 01 02 03 04 10 17 18 19 20 21
epidermis
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
nasal cavity epithelium
strong strong
homogeneousstrong expression: see section 06 09 11 13 14 15 moderate expression: see section 05 08 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1773
Entity Detected:Zfp750, zinc finger protein 750 ( MGI:2442210)
Sequence:sense strand is shown

>T1773
TGGCCTCGAGGCAGATTCGGACGAGGGGGAAGTCCAGTTCCTGAGGCTAAAGATCCTTCTAAAGATGGGC
AAAGGGATGCAGAAGAAGCCAAAATGAGCCCCCGAGCAGGGAGCGCTGCCACGGGCTCCCCGGGGAGGCC
AAGCCCCACCAACTTCACCCAAACAAGCCAAACATTCGAAGGCCTGTGTGACCTCTCAAACAAAGCAGCC
TCCTCCGGAACCCTAGAGCGACTCCAGCAAGCTGAGCAGAGCCCCACCGCCTTCAAACCTGTCCAAAGGG
GTTCAGAAAGCCCTCACTCTCAACCTCCTGCAAACAGAACAGAGTCTCCAAAAAGCCTTCAGGCCATGAA
TGGTGACCCTCCGGCCCAGACAGGGGAGCAGTAACTCTTTCATCACAGAGGCCCCACCCTCCAGCCCAGA
GGACCACTCCAGAATAGGTCCCCTTCAATCTCTCTAAGAAGCTGGGAGACAAACCCTGCAGCCACGTATG
GGACCCATGTATGCAAGC
Notes:The probe template was PCR amplified from IMAGE:492529 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:492529 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000069 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS