Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31455

Eed embryonic ectoderm development ( MGI:95286)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31455 EMAGE:31455 EMAGE:31455 EMAGE:31455 EMAGE:31455
euxassay_000063_01 euxassay_000063_02 euxassay_000063_03 euxassay_000063_04 euxassay_000063_05
EMAGE:31455 EMAGE:31455 EMAGE:31455 EMAGE:31455 EMAGE:31455
euxassay_000063_06 euxassay_000063_07 euxassay_000063_08 euxassay_000063_09 euxassay_000063_10
EMAGE:31455 EMAGE:31455 EMAGE:31455 EMAGE:31455 EMAGE:31455
euxassay_000063_11 euxassay_000063_12 euxassay_000063_13 euxassay_000063_14 euxassay_000063_15
EMAGE:31455 EMAGE:31455 EMAGE:31455 EMAGE:31455 EMAGE:31455
euxassay_000063_16 euxassay_000063_17 euxassay_000063_18 euxassay_000063_19 euxassay_000063_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cerebral cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 14 15 weak expression: see section 11 12
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 09 10 11 13 14 15 16 17 weak expression: see section 08 12
liver
moderate moderate
homogeneousmoderate expression: see section 01 02 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 weak expression: see section 12
metanephros
moderate moderate
homogeneousmoderate expression: see section 06 07 08 09 10 11 13 16 17 18 19 weak expression: see section 12
lung
moderate moderate
homogeneousmoderate expression: see section 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 weak expression: see section 12
nose
strong strong
regionalstrong expression: see section 08 09 10 11 13 14 15 16 17 18 moderate expression: see section 07 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1502
Entity Detected:Eed, embryonic ectoderm development ( MGI:95286)
Sequence:sense strand is shown

>T1502
TTTTTTTTTTTTTTACAAAAATAAATTTTTATTAAAAGCAGTAAAGTCCGAGCAGGAAGACAGTACAAAG
AATGTAAACAATGTGAACATCACTACATTCAGCTCAGCCTGATCGAATGCTGAAAAACAAGTCTAAATGC
TCTATGTGCCCTTACTAGCAAGATACATTACTTCTATTTTACAGACAACAGACTAATTTTTACTAGGAAA
AAATAGTTTATCGAAGTCGATCCCATCGCCAAATGCTGGCATCATCGCAGACAGCTATGAGGATGCTGCT
ATCCCTACTGAAACTGGTTTGTCGAATAGCCGCGCCACATTTATGATGGGTCAGTGTTGTGCATTTGGCT
TTATGAGGATCTTCTACTTCTAAATCCCAAACATACAGTTTGCCAACCTGATTGCCCAATGCAAGCATCT
TTTGCCAGAAATCCATAGAAAACCTCATGTACCAAATGTCACACTGGCTGTAATCAAATCGCCCAAGA
Notes:The probe template was PCR amplified from IMAGE:540416 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:540416 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000063 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS