Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31463

Osbpl6 ( MGI:2139014)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31463 EMAGE:31463 EMAGE:31463 EMAGE:31463 EMAGE:31463
euxassay_000065_01 euxassay_000065_02 euxassay_000065_03 euxassay_000065_04 euxassay_000065_05
EMAGE:31463 EMAGE:31463 EMAGE:31463 EMAGE:31463 EMAGE:31463
euxassay_000065_06 euxassay_000065_07 euxassay_000065_08 euxassay_000065_09 euxassay_000065_10
EMAGE:31463 EMAGE:31463 EMAGE:31463 EMAGE:31463 EMAGE:31463
euxassay_000065_11 euxassay_000065_12 euxassay_000065_13 euxassay_000065_14 euxassay_000065_15
EMAGE:31463 EMAGE:31463 EMAGE:31463 EMAGE:31463 EMAGE:31463
euxassay_000065_16 euxassay_000065_17 euxassay_000065_18 euxassay_000065_19 euxassay_000065_20
EMAGE:31463 EMAGE:31463 EMAGE:31463 EMAGE:31463
euxassay_000065_21 euxassay_000065_22 euxassay_000065_23 euxassay_000065_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
metencephalon lateral wall
moderate moderate
regionalmoderate expression: see section 07 08 12 13 14 15 16 17 18 19 20 21 22 23 weak expression: see section 09 10 11
pituitary gland
moderate moderate
regionalmoderate expression: see section 14 15 16 17
vestibulocochlear viii ganglion
strong strong
homogeneousstrong expression: see section 07 09 21 22 23 moderate expression: see section 06 08 10
metanephros
weak weak
spottedweak expression: see section 09 10 11 18 19 20 21 22 23
spinal cord
moderate moderate
regionalmoderate expression: see section 12 13 14 16 17 18 19 20
interdigital region between hindlimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 03 20 21 22 weak expression: see section 01 02
medulla oblongata lateral wall
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20 21
midbrain lateral wall
moderate moderate
regionalmoderate expression: see section 08 12 13 14 15 16 17 18 19 20 21 22 weak expression: see section 10 11
esophagus
moderate moderate
regionalmoderate expression: see section 09 11 12 weak expression: see section 13
facial vii ganglion
strong strong
homogeneousstrong expression: see section 05 06 21 22 23 moderate expression: see section 24
vagus x ganglion
strong strong
homogeneousstrong expression: see section 09 11 20 21 22 moderate expression: see section 10
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 14 15 17 18 weak expression: see section 16
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 04 05 06 07 09 19 20 21 22 23 moderate expression: see section 08 10 24
vibrissa
moderate moderate
regionalmoderate expression: see section 22 23 weak expression: see section 03 04 05 06 07 21 24
nasal cavity
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 20 21 23
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03
interdigital region between hindlimb digits 4 and 5
moderate moderate
regionalmoderate expression: see section 03 20 21 22 weak expression: see section 01 02
tongue epithelium
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15 16 17
stomach
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 08 09 11 12
interdigital region between hindlimb digits 3 and 4
moderate moderate
regionalmoderate expression: see section 03 20 21 22 weak expression: see section 01 02
cerebral cortex
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 13
urethra of male
weak weak
regionalweak expression: see section 13
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 21 22
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 11 12 13 14 15 18 19 20 21 22 moderate expression: see section 10 16 17
hypothalamus
moderate moderate
regionalmoderate expression: see section 15 16 17 18 19
olfactory lobe
moderate moderate
regionalmoderate expression: see section 09 10 11 12 15 16 17 18
submandibular gland primordium
weak weak
regionalweak expression: see section 10 11
interdigital region between hindlimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 03 20 21 22 weak expression: see section 01 02
adrenal gland
moderate moderate
regionalmoderate expression: see section 10 11 12 19 20 21
diencephalon lateral wall
moderate moderate
regionalmoderate expression: see section 08 11 12 13 14 15 16 17 18 19 20 weak expression: see section 09 10
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1571
Entity Detected:Osbpl6, ( MGI:2139014)
Sequence:sense strand is shown

>T1571
GCCTGGTGAGCAAATCCATGTCAGCCTCCCTCTGTCACAGCAGGTGGCCAACGAGAGCCGCCTCTCCATG
TCAGAATCCGTGTCAGAATTCTTCGATGCCCAAGAGGTGCTCCTGTCTGCAAGCTCATCAGAGAATGAGG
CTTCTGATGATGAGTCCTACATCAGCGACGTGAGTGACAACATATCTGAGGACAACACCAGTGTCGCCGA
CAACATTTCTCGGCAAATCCTGAATGGGGAGCTCACAGGAGGCGCCTTCCGCAATGGCCGTCGCACCTGC
CTGCCTGCTCCTTGCCCGGACACCAGTAACATTAACCTGTGGAATATCTTGAGGAACAACATTGGCAAAG
ACCTGTCGAAGGTCTCCATGCCCGTGGAACTCAACGAGCCCCTCAACACCCTGCAGCACCTCTGTGAGGA
AATGGAATACAGTGAGCTCCTGGACAAGGCCTCAGAGACCGACGACCCCTACGAGAGGATGGTTCTCGTC
GCTGCCTTTGCAGTCTCAGGGTACTGTTCCACCTACTTCCGAGCA
Notes:The probe template was PCR amplified from IMAGE:933504 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:933504 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000065 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS