Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31487

Bdh1 3-hydroxybutyrate dehydrogenase, type 1 ( MGI:1919161)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31487 EMAGE:31487 EMAGE:31487 EMAGE:31487 EMAGE:31487
euxassay_001930_01 euxassay_001930_02 euxassay_001930_03 euxassay_001930_04 euxassay_001930_05
EMAGE:31487 EMAGE:31487 EMAGE:31487 EMAGE:31487 EMAGE:31487
euxassay_001930_06 euxassay_001930_07 euxassay_001930_08 euxassay_001930_09 euxassay_001930_10
EMAGE:31487 EMAGE:31487 EMAGE:31487 EMAGE:31487 EMAGE:31487
euxassay_001930_11 euxassay_001930_12 euxassay_001930_13 euxassay_001930_14 euxassay_001930_15
EMAGE:31487 EMAGE:31487 EMAGE:31487 EMAGE:31487 EMAGE:31487
euxassay_001930_16 euxassay_001930_17 euxassay_001930_18 euxassay_001930_19 euxassay_001930_20
EMAGE:31487 EMAGE:31487 EMAGE:31487 EMAGE:31487
euxassay_001930_21 euxassay_001930_22 euxassay_001930_23 euxassay_001930_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
oral epithelium
strong strong
regionalstrong expression: see section 07 09 10 11 12 13 14 15 16 17 18 19 20 21 moderate expression: see section 08
foregut-midgut junction
strong strong
regionalstrong expression: see section 10
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 17 18
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 09 15
clavicle
strong strong
regionalstrong expression: see section 09 10 16 19 20 21 moderate expression: see section 05 06 07 08 17 18
spinal cord
strong strong
homogeneousstrong expression: see section 05 06 07 08 09 10 11 12 13
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10
bladder
weak weak
regionalweak expression: see section 12 13
esophagus
moderate moderate
regionalmoderate expression: see section 10 11
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 18 19 20 21
lower jaw molar
strong strong
regionalstrong expression: see section 08 09 10 11 19 20
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 22 23 moderate expression: see section 02 03 21
upper jaw molar
strong strong
regionalstrong expression: see section 08 09 10 11 19 20 21
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 21
vibrissa
strong strong
regionalstrong expression: see section 08 09 10 11 21 22 23 moderate expression: see section 24 weak expression: see section 06 07
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19
hindgut
strong strong
regionalstrong expression: see section 10 11 12
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 16
naris
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19
brain
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 16 17
midgut
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17
dorsal root ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 11 12 13 14 15 16
meckel's cartilage
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 13 19 20 21 22 moderate expression: see section 12
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 17 18 19
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
lower jaw incisor
strong strong
regionalstrong expression: see section 13 14 17 18 moderate expression: see section 12 15
upper jaw incisor
strong strong
regionalstrong expression: see section 13 14 17 18 moderate expression: see section 12 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T626
Entity Detected:Bdh1, 3-hydroxybutyrate dehydrogenase, type 1 ( MGI:1919161)
Sequence:sense strand is shown

>T626
TCCTCGAGNCTGTTGGCCTACTGGATCTTAGGTGGCTTTTCTGTCAGACTTGTGTGGGAATTTTCACTCC
CCGGTAAAGCACTGGAAGCAGACACATCAAGCCCGGAGAGATTTCCCTGGGCACTTATTACACCCTGCGG
GGAGTAAGAGGGCTCGGGGCATCTGGCTGGTCACTGTCTGGAGGGGGCTTGGCGTGCTGGTGGGTGCTGC
AGAAGAGGCCTCAGTGCACTGGCTAAGAGCCACCAGAAGGAAGCAGAGCGTCTTACAACTTGGTGCCACG
ATGCTAGCTGCCCGTCTCTCCAGACCCCTGTCACAGCTCCCAGGAAAAGCCCTAAGTGTCCGTGACAGAG
AAAATGGGACAAGACACACACTGTTGTTTTATCCAGCATCCTTCAGCCCTGACACCCGTCGGACCTACGC
CAGTCAGGCAGATGCGGCTAGTGGCAAAGCTATCCTGATCACAGGCTGTGACTCTGGATTTGGGTTCTCA
CTGGCCAAGCATCTGCACTCAAAAGGCTTCCTTGTATTTGCTGGCTGTTTGATG
Notes:The probe template was PCR amplified from IMAGE:1886294 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1886294 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001930 same experiment
 EMAGE:29659 same embryo
 EMAGE:31569 same embryo
 EMAGE:30402 same embryo
 EMAGE:30455 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS