Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31490

Kidins220 kinase D-interacting substrate 220 ( MGI:1924730)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31490 EMAGE:31490 EMAGE:31490 EMAGE:31490 EMAGE:31490
euxassay_009418_01 euxassay_009418_02 euxassay_009418_03 euxassay_009418_04 euxassay_009418_05
EMAGE:31490 EMAGE:31490 EMAGE:31490 EMAGE:31490 EMAGE:31490
euxassay_009418_06 euxassay_009418_07 euxassay_009418_08 euxassay_009418_09 euxassay_009418_10
EMAGE:31490 EMAGE:31490 EMAGE:31490 EMAGE:31490 EMAGE:31490
euxassay_009418_11 euxassay_009418_12 euxassay_009418_13 euxassay_009418_14 euxassay_009418_15
EMAGE:31490 EMAGE:31490 EMAGE:31490 EMAGE:31490 EMAGE:31490
euxassay_009418_16 euxassay_009418_17 euxassay_009418_18 euxassay_009418_19 euxassay_009418_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 15 16 17
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 07 weak expression: see section 12
spinal cord
strong strong
regionalstrong expression: see section 06 07 08 10 11 12 moderate expression: see section 09
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 15 16
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 15
thoracic ganglion
weak weak
regionalweak expression: see section 08 09
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 17 18 19
vagus x ganglion
strong strong
regionalstrong expression: see section 07 14
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 15 16 17 18 19 20
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 08 09 10 11 13 14 15 16 17
cervical ganglion
strong strong
regionalstrong expression: see section 07 moderate expression: see section 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36828
Entity Detected:Kidins220, kinase D-interacting substrate 220 ( MGI:1924730)
Sequence:sense strand is shown

>T36828
CACAGGCACTTTAACGTCTCACTACCACTGCTGTGCCCTTTCCTGACGCACAGCTCTGCAGAGATGAGAT
CAGGCTGAATACAGAGAGAGGTCGGAAATGTATTTAAATTGAAAGGGCTTAAGTCACAAGGAAATAAACC
CAGAGATCTCCTTTATAAACTATTCATGTAACATTTGAGGGGAGATATAGTATTAGATGAAGCAGAAACC
AATTTCACTGGTAGTGTTTAATCTTGGTGCAGATTTATAGGTTTTAGAGTAGCCCAGAAACTAAAAGTGA
ATACCTAGCAAATGGATAGCCAGTGTTCTGTATAAGAATCATTGCTTTTAAGAGGTCTTAAAATTTAAGT
AGAAAATACATACTAAAGAGGGCGTAAAAGTTGATGATTAAGTGAGTTAGCAGAGCCCAAAGCAGTGGCC
TGGGCCATGGTGAGTCGTTAGCAGAGGAGTTGGAGGAGGGCAGTGTATTCCTGGGATACTCTTTCCAACC
CAGCCCTGGCTTCCGACACCACCCACCTGTGCCCTCAAAACCATCTTAGTCTGTTCTGCAGCTACTAAGT
AATGCTCATGGCTAAAGAAAAGTTAGTGGTACTGGTGATGAAACGCAGGACCTCACAGATCTAAGTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 83656. Forward Primer - name:083656_F_cDNA_C330002I19Rik, sequence:CACAGGCACTTTAACGTCTCAC; Reverse Primer - name:083656_N_SP6_cDNA_C330002I19Rik, sequence:GGACTTAGATCTGTGAGGTCCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009418 same experiment
 EMAGE:30658 same embryo
 EMAGE:30086 same embryo
 EMAGE:30398 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS