Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31494

Cdh13 ( MGI:99551)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31494 EMAGE:31494 EMAGE:31494 EMAGE:31494 EMAGE:31494
euxassay_011981_01 euxassay_011981_02 euxassay_011981_03 euxassay_011981_04 euxassay_011981_05
EMAGE:31494 EMAGE:31494 EMAGE:31494 EMAGE:31494 EMAGE:31494
euxassay_011981_06 euxassay_011981_07 euxassay_011981_08 euxassay_011981_09 euxassay_011981_10
EMAGE:31494 EMAGE:31494 EMAGE:31494 EMAGE:31494 EMAGE:31494
euxassay_011981_11 euxassay_011981_12 euxassay_011981_13 euxassay_011981_14 euxassay_011981_15
EMAGE:31494 EMAGE:31494 EMAGE:31494 EMAGE:31494 EMAGE:31494
euxassay_011981_16 euxassay_011981_17 euxassay_011981_18 euxassay_011981_19 euxassay_011981_20
EMAGE:31494 EMAGE:31494 EMAGE:31494
euxassay_011981_21 euxassay_011981_22 euxassay_011981_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
humerus
strong strong
regionalstrong expression: see section 19 20 21 22 23
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 23
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
tarsus
strong strong
regionalstrong expression: see section 23
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 23
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 13
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 17 19
tibia
strong strong
regionalstrong expression: see section 23 moderate expression: see section 01 02 03
femur
strong strong
regionalstrong expression: see section 19 20 21 22 23 moderate expression: see section 02 03 04 05 17 18
upper lip
strong strong
regionalstrong expression: see section 06 07 08 14 15 16 17 18 19 20 moderate expression: see section 09
hand
moderate moderate
regionalmoderate expression: see section 01
telencephalon mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
lower lip
strong strong
regionalstrong expression: see section 07 08 14 19 20 moderate expression: see section 09
spinal cord mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13
fibula
strong strong
regionalstrong expression: see section 23 moderate expression: see section 01 02 03
pons marginal layer
strong strong
regionalstrong expression: see section 18
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 23
pons mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 13 14
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
meckel's cartilage
strong strong
regionalstrong expression: see section 11 16 17 20 21
scapula
strong strong
regionalstrong expression: see section 19
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30068
Entity Detected:Cdh13, ( MGI:99551)
Sequence:sense strand is shown

>T30068
CATTGTGGTGTCCCCCATCTTGATCCCAGAGAACCAGAGACAGCCCTTCCCCAGAGATGTCGGCAAGGTA
GTCGATAGCGACAGACCCGAAGGGTCCAAGTTCCGGCTCACCGGGAAGGGAGTGGATCAAGACCCTAAAG
GAACTTTCAGAATCAATGAGAACACAGGCAGCGTCTCCGTGACACGGACCCTGGACAGAGAAACGATCGC
TACTTATCAACTGTATGTGGAAACCACGGATGCCAGTGGCAAAACTCTGGAAGGGCCAGTGCCTCTGGAA
GTCATTGTGATTGACCAGAACGACAACAGACCCATCTTCCGGGAAGGCCCTTACATCGGCCATGTCATGG
AAGGGTCACCCACAGGGACCACGGTGATGCGGATGACAGCGTTTGATGCAGATGACCCGGCTACTGACAA
TGCTCTCCTGAGGTACAACATCCGTCAGCAGACGCCTGACAAGCCATCTCCTAACATGTTCTACATCGAT
CCCGAGAAAGGAGACATTGTCACCGTGGTGTCACCTGCGCTGCTGGACCGGGAGACTCTGGAAAACCCCA
AGTATGAACTGATCATCGAAGCTCAAGATATGGCAGGATTGGATGTCGGACTGACAGGCACAGCCACAGC
CACCATCGTGATCGATGACAAAAATGATCACTCACCAAAATTCACCAAGAAAGAGTTTCAAGCCACAGTG
GAGGAGGGAGCTGTGGGGGTCATTGTCAACTTGACAGTGGAAGACAAAGACGACCCCACCACAGGAGCCT
GGAGGGCTGCATACACCATCATCAATGGAAATCCTGGGCAGAGCTTCGAGATCCACACCAACC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3987627), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 9089. Forward Primer - name:009089_F_IRAV20-23_D09_Cdh13, sequence:CATTGTGGTGTCCCCCAT; Reverse Primer - name:009089_R_SP6_IRAV20-23_D09_Cdh13, sequence:GGGTTGGTGTGGATCTC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011981 same experiment
 EMAGE:31209 same embryo
 EMAGE:31495 same embryo
 EMAGE:31890 same embryo
 EMAGE:31498 same embryo
 EMAGE:31497 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS