Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31519

Runx1 runt related transcription factor 1 ( MGI:99852)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31519 EMAGE:31519 EMAGE:31519 EMAGE:31519 EMAGE:31519
euxassay_019458_01 euxassay_019458_02 euxassay_019458_03 euxassay_019458_04 euxassay_019458_05
EMAGE:31519 EMAGE:31519 EMAGE:31519 EMAGE:31519 EMAGE:31519
euxassay_019458_06 euxassay_019458_07 euxassay_019458_08 euxassay_019458_09 euxassay_019458_10
EMAGE:31519 EMAGE:31519 EMAGE:31519 EMAGE:31519 EMAGE:31519
euxassay_019458_11 euxassay_019458_12 euxassay_019458_13 euxassay_019458_14 euxassay_019458_15
EMAGE:31519 EMAGE:31519 EMAGE:31519 EMAGE:31519 EMAGE:31519
euxassay_019458_16 euxassay_019458_17 euxassay_019458_18 euxassay_019458_19 euxassay_019458_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 08 09
sternum
strong strong
regionalstrong expression: see section 13 14 15
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 16 17 18
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 moderate expression: see section 07
clavicle
strong strong
regionalstrong expression: see section 07 08 09 10 15 moderate expression: see section 16
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 18 19
axial skeleton
moderate moderate
regionalmoderate expression: see section 14 15 16 weak expression: see section 07 09 17
axial skeleton tail region
strong strong
regionalstrong expression: see section 15 16 moderate expression: see section 17 18
viscerocranium
strong strong
regionalstrong expression: see section 18 19 20 moderate expression: see section 17
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 19
lower jaw molar
strong strong
regionalstrong expression: see section 18
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 18 moderate expression: see section 19 20
upper jaw molar
strong strong
regionalstrong expression: see section 18
trachea
strong strong
regionalstrong expression: see section 12 moderate expression: see section 13
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 08 09 moderate expression: see section 06 07
thymus primordium
strong strong
regionalstrong expression: see section 10 11 12 13 14
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 16 17 18 19 20
tibia
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 05
femur
weak weak
regionalweak expression: see section 05 06 07
vibrissa
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 19 20
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 16 moderate expression: see section 13
midbrain mantle layer
strong strong
regionalstrong expression: see section 17 18 moderate expression: see section 05
orbito-sphenoid
strong strong
regionalstrong expression: see section 19 20 moderate expression: see section 01 02 03 04 05 12
cornea epithelium
strong strong
regionalstrong expression: see section 02 03 04
mandible
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 18 moderate expression: see section 02 03 04 05 06 07 08 16 17 19 20
cricoid cartilage
strong strong
regionalstrong expression: see section 11 weak expression: see section 13
larynx
strong strong
regionalstrong expression: see section 11 12
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 08 moderate expression: see section 07
stomach
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 05 06 08
thyroid cartilage
strong strong
regionalstrong expression: see section 10 11 12 weak expression: see section 13
fibula
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 05
rib
strong strong
regionalstrong expression: see section 01 02 03 04 12 moderate expression: see section 05 weak expression: see section 06 07 08 09 10 11 16 17 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 17 18
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 08 moderate expression: see section 06 07
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 15 moderate expression: see section 08 09
basioccipital bone
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 10
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 10
maxilla
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 18 moderate expression: see section 02 03 04 05 06 07 08 16 19 20
lower jaw incisor
strong strong
regionalstrong expression: see section 06 10 11 12 14 15 16 moderate expression: see section 13
upper jaw incisor
strong strong
regionalstrong expression: see section 06 10 11 12 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55169
Entity Detected:Runx1, runt related transcription factor 1 ( MGI:99852)
Sequence:sense strand is shown

>T55169
AGCATGGTGGAGGTACTAGCTGACCACCCTGGCGAGCTAGTGCGCACCGACAGCCCCAACTTCCTCTGCT
CCGTGCTACCCACTCACTGGCGCTGCAACAAGACCCTGCCCATCGCTTTCAAGGTGGTGGCACTGGGGGA
CGTCCCGGATGGCACTCTGGTCACCGTCATGGCAGGCAACGATGAAAACTACTCGGCAGAACTGAGAAAT
GCTACCGCGGCCATGAAGAACCAGGTAGCGAGATTCAACGACCTCAGGTTTGTCGGGCGGAGCGGTAGAG
GCAAGAGCTTCACTCTGACCATCACCGTCTTTACAAATCCGCCACAAGTTGCCACCTACCATAGAGCCAT
CAAAATCACAGTGGACGGCCCCCGAGAACCCCGAAATGCCAGGCAGATCCAGCCATCCCCACCGTGGTCC
TATGACCAGTCCTACCAGTACCTGGGATCCATCACCTCTTCCTCTGTCCACCCAGCGACACCCATTTCAC
CCGGCCGTGCCAGCGGCATGACCAGCCTCTCTGCAGAACTTTCCAGTCGACTCTCAACGGCTCCGGACCT
GACCGCCTTCGGCGACCCACGCCAGTTCCCTACTCTGCCGTCCATCTCCGACCCGCGCATGCACTACCCA
GGCGCCTTCACCTACTCGCCGCCCGTCACGTCGGGCATCGGCATCGGCATGTCAGCCATGAGCTCGGCCT
CTCGCTACCACACCTACCTGCCGCCGCCCTACCCCGGCTCATCACAGGCGCAGGCCGGGCCCTTCCAGAC
CGGCTCGCCCTCCTACCATCTATACTACGGCGCCTCGGCCGGTTCCTACCAGTTCTCCATGGTGGGCGGA
GAGAGATCGCCCCCGCGCATCCTGCCGCCCTGCACCAACGCATCCACCGGCGCCGCGCTGCTCAACCCCA
GCCTCCCCAGCCAGAGCGACGTGGTGGAGACCGAGGGCAGCCATAGCAACTCGCCCACCAACATG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. .
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_019458 same experiment
 EMAGE:31626 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS