Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31535

Slc4a3 ( MGI:109350)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31535 EMAGE:31535 EMAGE:31535 EMAGE:31535 EMAGE:31535
euxassay_007248_01 euxassay_007248_02 euxassay_007248_03 euxassay_007248_04 euxassay_007248_05
EMAGE:31535 EMAGE:31535 EMAGE:31535 EMAGE:31535 EMAGE:31535
euxassay_007248_06 euxassay_007248_07 euxassay_007248_08 euxassay_007248_09 euxassay_007248_10
EMAGE:31535 EMAGE:31535 EMAGE:31535 EMAGE:31535 EMAGE:31535
euxassay_007248_11 euxassay_007248_12 euxassay_007248_13 euxassay_007248_14 euxassay_007248_15
EMAGE:31535 EMAGE:31535 EMAGE:31535 EMAGE:31535 EMAGE:31535
euxassay_007248_16 euxassay_007248_17 euxassay_007248_18 euxassay_007248_19 euxassay_007248_20
EMAGE:31535 EMAGE:31535 EMAGE:31535 EMAGE:31535
euxassay_007248_21 euxassay_007248_22 euxassay_007248_23 euxassay_007248_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 09 10 11 14 15 16 17
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 12
vestibulocochlear viii ganglion
moderate moderate
single cellmoderate expression: see section 05 06 16 17 18
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 05 17
pons mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
dorsal root ganglion
weak weak
regionalweak expression: see section 05 06 07 08 13 14 15
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15
vagus x ganglion
moderate moderate
single cellmoderate expression: see section 06 16
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 01 02 03 04 05 06 07 08 16 17 18 19 20 21
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 15 16 17 18 19 20 21 22 23 24
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6319
Entity Detected:Slc4a3, ( MGI:109350)
Sequence:sense strand is shown

>T6319
CCAGGAGGAGGGGGGAGCTGGAGCAGAAGAGGAGGAGGAGGAAGAAGAGGAAGAAGAGGGAGAGTCTGAG
GCAGAGCCTGTGGAGCCTCTACCCCCAGGTCCCCCACAGAAAGCAAAGTTCTCCATTGGAAGTGATGAAG
ATGACAGCCCAGGCCTTCCTGTCAAGGCTCCCTGTGCCAAGGCCTTGCCTTCTGTGGGCCTGCAGTCTGA
CCAGAGCCCCCAGCGCTCCGGCAGCTCCCCCAGTCCCCGGGCCCGGGCTTCCCGAATCTCCACAGAGAAG
AGCCGGCCCTGGAGTCCATCAGCCAGCTATGACCTGCGGGAGCGATTGTGCCCAGGCAGTGCCCTGGGCA
ACCCTGGGCCAGAGCAGCGGGTGCCCACTGACGAGGCGGAGGCTCAAATGTTGGGTTCTGCCGATCTGGA
CGACATGAAGAGTCATCGGCTGGAGGATAACCCCGGGGTGCGGCGACACTTGGTGAAGAAACCATCCCGG
ATACAGGGTGGGAGAGGCAGCCCCAGTGGCCTGGCGCCCATCTTGCGCAGGAAAAAGAAGAAGAAGAAGC
TGGATCGGAGGCCTCATGAGGTGTTCGTGGAGCTGAATGAGCT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers.. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007248 same experiment
 EMAGE:31895 same embryo
 EMAGE:31785 same embryo
 EMAGE:29950 same embryo
 EMAGE:31502 same embryo
 EMAGE:31897 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS