Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31561

2700055K07Rik ( MGI:1915221)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31561 EMAGE:31561 EMAGE:31561 EMAGE:31561 EMAGE:31561
euxassay_009872_01 euxassay_009872_02 euxassay_009872_03 euxassay_009872_04 euxassay_009872_05
EMAGE:31561 EMAGE:31561 EMAGE:31561 EMAGE:31561 EMAGE:31561
euxassay_009872_06 euxassay_009872_07 euxassay_009872_08 euxassay_009872_09 euxassay_009872_10
EMAGE:31561 EMAGE:31561 EMAGE:31561 EMAGE:31561 EMAGE:31561
euxassay_009872_11 euxassay_009872_12 euxassay_009872_13 euxassay_009872_14 euxassay_009872_15
EMAGE:31561 EMAGE:31561 EMAGE:31561 EMAGE:31561 EMAGE:31561
euxassay_009872_16 euxassay_009872_17 euxassay_009872_18 euxassay_009872_19 euxassay_009872_20
EMAGE:31561 EMAGE:31561
euxassay_009872_21 euxassay_009872_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 08 09
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 weak expression: see section 16
thoracic ganglion
weak weak
regionalweak expression: see section 12
diaphragm
weak weak
regionalweak expression: see section 02 03 04 05 07 09 10 17 18 19 20 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 18 19 20
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 17 18 19 20 21 22 weak expression: see section 15 16
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 16 17 18 19 20 21
tibia
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 01
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 03 04 20
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 weak expression: see section 08 09 13
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
cervical ganglion
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 08 09
neural retina
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 02 03 04
shoulder rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02
ventral grey horn
strong strong
regionalstrong expression: see section 09 10 11 12 13 weak expression: see section 08
extrinsic ocular muscle
weak weak
regionalweak expression: see section 04 05 06 07 19 20 21 22
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 11
fibula
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 01
pons ventricular layer
strong strong
regionalstrong expression: see section 11 moderate expression: see section 12
foot mesenchyme
weak weak
regionalweak expression: see section 06 18
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 08 16 17
pons mantle layer
strong strong
regionalstrong expression: see section 07 16 17 moderate expression: see section 08 09 10 13 15
tongue muscle
weak weak
regionalweak expression: see section 11 12 13 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 13 14 15 16
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 08 09 14 15 moderate expression: see section 10 12 13
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 10 11 13 14
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 13
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30928
Entity Detected:2700055K07Rik, ( MGI:1915221)
Sequence:sense strand is shown

>T30928
GAGCTGTGGAGCCTCCTGGTCTCCAGCATCAGTTCCTGGGTCCTGTCCGAAGGCACGCTCAGGAGCAGCC
AAGCGGTAGAAGCCGGGTGGCATGGCAGCGAGCACGGACATAGCTGGGCTGGAGGAGAGCTTCCGGAAGT
TTGCCATCCATGGCGACCCCAAGGCCAGCGGGCAAGAGATGAATGGCAAGAACTGGGCCAAGCTGTGCAA
GGACTGTAAGGTGGCCGACGGAAAGGCCGTAACGGGCACCGACGTCGACATCGTCTTCTCCAAAGTCAAG
GCGAAATCTGCTAGAGTAATCAACTATGAGGAGTTCAAGAAGGCCCTGGAAGAGCTGGCAACTAAGCGGT
TCAAGGGGAAGTCCAAGGAGGAGGCCTTTGATGCCATCTGCCAGCTGATAGCGGGCAAGGAACCGGCCAA
CATTGGCGTCACCAAAGCTAAAACGGGTGGTGCTGTGGACCGGCTGACGGACACCAGTAAGTATACGGGC
TCCCACAAAGAACGCTTTGATGAGAGCGGCAAGGGAAAGGGCATCGCTGGACGGCAGGACATCCTGGACG
ACAGTGGCTACGTGAGTGCCTACAAAAACGCAGGCACCTATGACGCCAAGGTGAAGAAGTGACACCTGCC
AAAGCCCCCAGGGAGGCTGTCCCACTGGAGGCCCAGGCCTGGGGTCCAGGGTCACATGGAGCAAGAAAGC
CTGGCTCCCTCCCTGCTGGATCTGCCACCAAGAGCTTCCTGCCCAGTCCCAGGGCCATCCCATCAGGCCT
CTGACCCAGACTGCTGTGTCCCTTCTTCCTGTCTCCCTGTCATCTGTCTGGGAGTCAGTGCCTATATCCT
CACCGCCCCAGCCTGGTCCCAGGCATGGCTGACTCTTGCCTGCTTTTGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4216285), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 18571. Forward Primer - name:018571_F_IRAV28-31_D19_2700055K07Rik, sequence:GAGCTGTGGAGCCTCCTG; Reverse Primer - name:018571_R_SP6_IRAV28-31_D19_2700055K0, sequence:AGGCAAAAGCAGGCAAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009872 same experiment
 EMAGE:31383 same embryo
 EMAGE:31574 same embryo
 EMAGE:30462 same embryo
 EMAGE:31584 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS