Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31570

Etl4 enhancer trap locus 4 ( MGI:95454)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31570 EMAGE:31570 EMAGE:31570 EMAGE:31570 EMAGE:31570
euxassay_001929_01 euxassay_001929_02 euxassay_001929_03 euxassay_001929_04 euxassay_001929_05
EMAGE:31570 EMAGE:31570 EMAGE:31570 EMAGE:31570 EMAGE:31570
euxassay_001929_06 euxassay_001929_07 euxassay_001929_08 euxassay_001929_09 euxassay_001929_10
EMAGE:31570 EMAGE:31570 EMAGE:31570 EMAGE:31570 EMAGE:31570
euxassay_001929_11 euxassay_001929_12 euxassay_001929_13 euxassay_001929_14 euxassay_001929_15
EMAGE:31570 EMAGE:31570 EMAGE:31570 EMAGE:31570 EMAGE:31570
euxassay_001929_16 euxassay_001929_17 euxassay_001929_18 euxassay_001929_19 euxassay_001929_20
EMAGE:31570 EMAGE:31570 EMAGE:31570
euxassay_001929_21 euxassay_001929_22 euxassay_001929_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cerebral cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 14 15 16 17 18 19 weak expression: see section 01 02 03 04 05 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2574
Entity Detected:Etl4, enhancer trap locus 4 ( MGI:95454)
Sequence:sense strand is shown

>T2574
NANAATGATCATATTGCTGTATCGTTCAAGGCTTCATGCAGAGTATGTGCTAAGTACTGAGTTGGTAGCT
GCAGTAAAGCTTGTTTTTTTTCCACTCTGTTGCTGTTGTAATTGCATAGTGTTTACTGTCTAGATTCGAT
ACCTATTACATGAAGAAAGCATGTGCTATAAAAAGAGAGAGTATGATGAGAGTGAAGACATGTGTGAGAC
AAGCTGACTGTACTATGCATGTAAAACATGTATGATTCCAGAATTTTAGTATGTTTTGTATAAAAATATT
TTTCATTACAGAGACTAGAGGCAAACAGAGAAATAAATACGCAAGCGTGACTATATAAATTGTAAAGCAT
ATATTATGATATTTTCTTTTATTTTAGTGTTATTTAGCTTTATTACAGATTTCTATTTTTGTCAAAACTT
CATGGTTCCTTTCAAAATCTTTTTTGCCAAAACATTTTGATACTACAGCATTGTACATTTGAAAGTAGCG
TGC
Notes:The probe template was PCR amplified from IMAGE:1383121 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1383121 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001929 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS