Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31574

Eno3 enolase 3, beta muscle ( MGI:95395)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31574 EMAGE:31574 EMAGE:31574 EMAGE:31574 EMAGE:31574
euxassay_009880_01 euxassay_009880_02 euxassay_009880_03 euxassay_009880_04 euxassay_009880_05
EMAGE:31574 EMAGE:31574 EMAGE:31574 EMAGE:31574 EMAGE:31574
euxassay_009880_06 euxassay_009880_07 euxassay_009880_08 euxassay_009880_09 euxassay_009880_10
EMAGE:31574 EMAGE:31574 EMAGE:31574 EMAGE:31574 EMAGE:31574
euxassay_009880_11 euxassay_009880_12 euxassay_009880_13 euxassay_009880_14 euxassay_009880_15
EMAGE:31574 EMAGE:31574 EMAGE:31574 EMAGE:31574 EMAGE:31574
euxassay_009880_16 euxassay_009880_17 euxassay_009880_18 euxassay_009880_19 euxassay_009880_20
EMAGE:31574 EMAGE:31574 EMAGE:31574
euxassay_009880_21 euxassay_009880_22 euxassay_009880_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
diaphragm
moderate moderate
regionalmoderate expression: see section 09 17 18 19 21 22 weak expression: see section 02 03 04 05 06 07 08 10 16 20
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 17 18 19 20 21 22 23 weak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30932
Entity Detected:Eno3, enolase 3, beta muscle ( MGI:95395)
Sequence:sense strand is shown

>T30932
CACATCTCCTGTGGTGCAGCCATGGCCATGCAAAAAATCTTCGCCCGGGAAATCCTGGACTCCAGGGGCA
ACCCCACGGTGGAGGTGGACCTGCACACAGCCAAGGGTCGATTCCGAGCAGCTGTGCCCAGTGGAGCTTC
CACGGGTATCTATGAAGCACTGGAACTCCGAGATGGAGACAAAGCACGATACCTGGGGAAAGGAGTGCTG
AAGGCTGTGGAACACATCAACAAGACTCTAGGTCCTGCTCTGCTGGAAAAGAAACTAAGTGTTGTGGATC
AAGAAAAAGTTGACAAGTTCATGATTGAGCTGGACGGGACCGAGAATAAGTCCAAGTTTGGGGCCAACGC
CATCCTGGGTGTGTCCCTGGCTGTCTGCAAGGCTGGAGCAGCTGAGAAAGGGGTCCCTCTCTACCGACAC
ATCGCAGATCTTGCAGGCAATCCCGACCTCGTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4217678), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 35369. Forward Primer - name:035369_F_IRAV28-31_F06_Eno3, sequence:CACATCTCCTGTGGTGCAG; Reverse Primer - name:035369_R_SP6_IRAV28-31_F06_Eno3, sequence:GTACGAGGTCGGGATTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009880 same experiment
 EMAGE:31561 same embryo
 EMAGE:31383 same embryo
 EMAGE:30462 same embryo
 EMAGE:31584 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS