Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31607

Drg1 developmentally regulated GTP binding protein 1 ( MGI:1343297)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31607 EMAGE:31607 EMAGE:31607 EMAGE:31607 EMAGE:31607
euxassay_019652_01 euxassay_019652_02 euxassay_019652_03 euxassay_019652_04 euxassay_019652_05
EMAGE:31607 EMAGE:31607 EMAGE:31607 EMAGE:31607 EMAGE:31607
euxassay_019652_06 euxassay_019652_07 euxassay_019652_08 euxassay_019652_09 euxassay_019652_10
EMAGE:31607 EMAGE:31607 EMAGE:31607 EMAGE:31607 EMAGE:31607
euxassay_019652_11 euxassay_019652_12 euxassay_019652_13 euxassay_019652_14 euxassay_019652_15
EMAGE:31607 EMAGE:31607 EMAGE:31607 EMAGE:31607 EMAGE:31607
euxassay_019652_16 euxassay_019652_17 euxassay_019652_18 euxassay_019652_19 euxassay_019652_20
EMAGE:31607 EMAGE:31607 EMAGE:31607 EMAGE:31607
euxassay_019652_21 euxassay_019652_22 euxassay_019652_23 euxassay_019652_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
weak weak
regionalweak expression: see section 11 13 17 18 19 20
thymus primordium
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 15 16 17
adrenal gland
moderate moderate
regionalmoderate expression: see section 09 10 11
vibrissa
moderate moderate
regionalmoderate expression: see section 19 20 21 weak expression: see section 04 05
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 17 weak expression: see section 02 03 04 05 06 07 08 16 18 19 20 21 22
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 17 weak expression: see section 12 18
liver
moderate moderate
regionalmoderate expression: see section 03 05 06 07 21 22 23 24 weak expression: see section 01 02 04 08 09 10 11 13 14 15 17 18 19 20
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 13 14 15
metanephros
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 18 19 20 21
testis
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 08 09 20 21 22 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55034
Entity Detected:Drg1, developmentally regulated GTP binding protein 1 ( MGI:1343297)
Sequence:sense strand is shown

>T55034
GAAGTCCTCTTGCCATCTGCTGGCTGGCCACAGCAGTGTTCCTTATGACTAAGTACCTTCCTCAGCCCCT
CTGTCTTTGGCAGCCTCTGGATTGGGATACAGGGATTGATATGGAGACTTATCAAACTGAAACACCACAA
TTTTTTTCTTTCCGGAGATAGGGTGTTATGTATTTCAGGCTGGCTTTGAACTCTTGCAGCTGAGGCTGGC
CTAGAATCCCTTTCATCAGCCTCCATCTCCTCAGTGCTGGGCTTACCACTGTGCACCTTTAGCTCCTCAG
CAACACCACTTTCCCTACTTTGCTGTCACTTCTATTGAACTGTATAAAGAAGCTGGTGGGCC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. .
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_019652 same experiment
 EMAGE:13700 same embryo
 EMAGE:13701 same embryo
 EMAGE:13702 same embryo
 EMAGE:13703 same embryo
 EMAGE:13704 same embryo
 EMAGE:13705 same embryo
 EMAGE:13706 same embryo
 EMAGE:13707 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS