Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31608

Abat ( MGI:2443582)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31608 EMAGE:31608 EMAGE:31608 EMAGE:31608 EMAGE:31608
euxassay_001907_01 euxassay_001907_02 euxassay_001907_03 euxassay_001907_04 euxassay_001907_05
EMAGE:31608 EMAGE:31608 EMAGE:31608 EMAGE:31608 EMAGE:31608
euxassay_001907_06 euxassay_001907_07 euxassay_001907_08 euxassay_001907_09 euxassay_001907_10
EMAGE:31608 EMAGE:31608 EMAGE:31608 EMAGE:31608 EMAGE:31608
euxassay_001907_11 euxassay_001907_12 euxassay_001907_13 euxassay_001907_14 euxassay_001907_15
EMAGE:31608 EMAGE:31608 EMAGE:31608 EMAGE:31608 EMAGE:31608
euxassay_001907_16 euxassay_001907_17 euxassay_001907_18 euxassay_001907_19 euxassay_001907_20
EMAGE:31608 EMAGE:31608 EMAGE:31608 EMAGE:31608
euxassay_001907_21 euxassay_001907_22 euxassay_001907_23 euxassay_001907_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
spinal cord mantle layer
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 06 12
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 16
pons ventricular layer
strong strong
regionalstrong expression: see section 05 07 08 09 10 11 12 13 14 15 16
medulla oblongata alar plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 15 16 17 18 19
pons mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 11 12 13
medulla oblongata basal plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13
thymus primordium
weak weak
regionalweak expression: see section 09 10 11 12 13
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 17 18 19 20 21
midbrain ventricular layer
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13
cervical ganglion
moderate moderate
regionalmoderate expression: see section 06 07 13
telencephalon mantle layer
strong strong
regionalstrong expression: see section 03 04 05 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 moderate expression: see section 06 07
midbrain mantle layer
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 moderate expression: see section 06 07
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T605
Entity Detected:Abat, ( MGI:2443582)
Sequence:sense strand is shown

>T605
GTTGGCCTACTGGTATTCATCATATTGGTTTAAGCATGCTGCCTCCTGAGAGCCACAGTGTCATATACAG
ATACTTCCGCAGGTCCTTAGAGTTCAAAGGGTTTTAATCCAGGACATAAGCAGAAATCGCTCTCTTTAGT
GAAGGGAGCAGCTGATTTTTTCATTTTCTTGCCACAAGGCATGTTGACAGAAGAATAAAATTCTTTGTAG
ACAGTCATCTTCAAATGTACTGTCCGCCCCTTGCCTGGAGACAGTTCTTCCCATTTTAAACAAACAAACA
AAATTTAAGGCGTTTATCCACAAGTTCTTGACTCGGGTACAGTGCGTTCCTGAGACACCCTCTTTGGGAG
CACAGGCAGTTAGCTGGAAGAACTCCAAGGAAAAGAATTTTCCACAAAACTCAAGAATGTCGAGACTTAA
CGAAGGCTGATGGAAACCCAGGAAGCCCAGTGGGCAGCTTCTGCCTAGGGCAGAGCCCACAAACCAGTGC
GTCTGTGCAGAACGTCTGGATGGACACCCATC
Notes:The probe template was PCR amplified from IMAGE:1885823 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1885823 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001907 same experiment
 EMAGE:31709 same embryo
 EMAGE:30441 same embryo
 EMAGE:30452 same embryo
 EMAGE:30440 same embryo
 EMAGE:30433 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS