Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31616

2410127E16Rik ( MGI:1924037)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31616 EMAGE:31616 EMAGE:31616 EMAGE:31616 EMAGE:31616
euxassay_006356_01 euxassay_006356_02 euxassay_006356_03 euxassay_006356_04 euxassay_006356_05
EMAGE:31616 EMAGE:31616 EMAGE:31616 EMAGE:31616 EMAGE:31616
euxassay_006356_06 euxassay_006356_07 euxassay_006356_08 euxassay_006356_09 euxassay_006356_10
EMAGE:31616 EMAGE:31616 EMAGE:31616 EMAGE:31616 EMAGE:31616
euxassay_006356_11 euxassay_006356_12 euxassay_006356_13 euxassay_006356_14 euxassay_006356_15
EMAGE:31616 EMAGE:31616 EMAGE:31616 EMAGE:31616 EMAGE:31616
euxassay_006356_16 euxassay_006356_17 euxassay_006356_18 euxassay_006356_19 euxassay_006356_20
EMAGE:31616 EMAGE:31616 EMAGE:31616 EMAGE:31616
euxassay_006356_21 euxassay_006356_22 euxassay_006356_23 euxassay_006356_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 04 05 06 15 16 17
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 06 07 12 13
spinal cord
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11
brain
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 04 05 15 16
trigeminal v nerve
weak weak
regionalweak expression: see section 08 09 16
thoracic ganglion
weak weak
regionalweak expression: see section 09 10 11
dorsal root ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 05 06 18 19
vagus x ganglion
weak weak
regionalweak expression: see section 06 15
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 11 12 15 16 17
cervical ganglion
weak weak
regionalweak expression: see section 06 07 14 15
naris
weak weak
regionalweak expression: see section 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35054
Entity Detected:2410127E16Rik, ( MGI:1924037)
Sequence:sense strand is shown

>T35054
AAATCAGAGACGTGATGGTGTGGTCCAACGAACGGGTCATGGGTTGGGTGTCTGGTCTTGGCCTGAAGGA
ATTTGCTACGAATCTCACGGAGAGTGGGGTGCACGGCGCACTGTTGGCTCTGGATGAAACCTTCGACTAC
TCCGATCTGGCCTTGCTTCTACAGATACCTACGCAGAATGCACAAGCTCGGCAACTGCTGGAGAAAGAAT
TCAGTAACCTCATCTCCTTAGGCACAGACAGACGGCTGGATGAGGACAGTGCCAAGTCCTTCAGCCGCTC
CCCATCCTGGAGGAAGATGTTCCGCGAGAAGGACCTCCGGGGTGTAACCCCCGATTCAGCCGAGATGTTA
CCCCCCAACTTTCGCTCAGCTGCCGCAGGAGCCCTAGGCTCTCCCGGGCTTCCTCTCCGCAAACTGCAGC
CTGAAGGCCAGACTTCTGGGAGTTCGCGAGCAGATGGTGTTTCGGTCCGGACTTACTCCTGCTAGTGTGC
ACCTCCAGAGCATTGTCTAGCAGGAGACCGCCGTGAGGGAGCTCGCCCTACGGACTGCACCACCTATACA
TACCAGCCGGGTGTGCGTGTTCCCGCCTCCCAAATGGACTGGGCCTGGACCAAACCATAAGAAATGGACT
GAAAGGGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 80413. Forward Primer - name:080413_F_cDNA_2410127E16Rik, sequence:AAATCAGAGACGTGATGGTGTG; Reverse Primer - name:080413_N_SP6_cDNA_2410127E16Rik, sequence:CCCCCTTTCAGTCCATTTCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006356 same experiment
 EMAGE:31639 same embryo
 EMAGE:32100 same embryo
 EMAGE:31572 same embryo
 EMAGE:31573 same embryo
 EMAGE:30469 same embryo
 EMAGE:30898 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS