Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31634

1810041L15Rik ( MGI:1919551)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31634 EMAGE:31634 EMAGE:31634 EMAGE:31634 EMAGE:31634
euxassay_006325_01 euxassay_006325_02 euxassay_006325_03 euxassay_006325_04 euxassay_006325_05
EMAGE:31634 EMAGE:31634 EMAGE:31634 EMAGE:31634 EMAGE:31634
euxassay_006325_06 euxassay_006325_07 euxassay_006325_08 euxassay_006325_09 euxassay_006325_10
EMAGE:31634 EMAGE:31634 EMAGE:31634 EMAGE:31634 EMAGE:31634
euxassay_006325_11 euxassay_006325_12 euxassay_006325_13 euxassay_006325_14 euxassay_006325_15
EMAGE:31634 EMAGE:31634 EMAGE:31634 EMAGE:31634 EMAGE:31634
euxassay_006325_16 euxassay_006325_17 euxassay_006325_18 euxassay_006325_19 euxassay_006325_20
EMAGE:31634 EMAGE:31634 EMAGE:31634 EMAGE:31634
euxassay_006325_21 euxassay_006325_22 euxassay_006325_23 euxassay_006325_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 weak expression: see section 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 18 19 20 21
neural retina
moderate moderate
regionalmoderate expression: see section 23 weak expression: see section 01 02 03 24
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 12 14 15 16 17 weak expression: see section 09 10
metencephalon lateral wall
moderate moderate
regionalmoderate expression: see section 07 13 17 18 19 weak expression: see section 08 09
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 19 weak expression: see section 01 02 03 04 05 06 07 08 09 10 17 18 20 21 22
midbrain mantle layer
weak weak
single cellweak expression: see section 06 07 08 09 10 11 13 14 15 16 17 18
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15 16 17 18 weak expression: see section 07
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 07 08 17
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17
medulla oblongata lateral wall
moderate moderate
regionalmoderate expression: see section 07 17 18 weak expression: see section 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35014
Entity Detected:1810041L15Rik, ( MGI:1919551)
Sequence:sense strand is shown

>T35014
CAAACAGGGGTTAGAGGTCAAGGTTTTACCCAATGCTGCCTCCGGAGATATTACTGGAGGCAAGAGCTGT
GTCCATGTGGGTATGAGCGCCCGGGTGGGTTGCAGGACCCCAGGTGGCCATGATGAAAATCTGTCCCTTG
CCCATGGTATCTATGGGTAACAGATATGCCAATGAGTAGCATGTCCTAAAAGGATACAGAGTAGAGACAA
GGTCCCGAACAGTTGTTGAGCTGTGTTGCTGCTAAACTTCCCCACTGCTGTCTCCTCCAGCTGCGTCTGT
CCTCTTCTTCCCATGAGCCTCAGGCTACAGACAGTACATGCTGGCAGCAACAAGTAGCCACAGGAAGCAG
AGAAGCTGCAGACATGGTGTGCCCATGGAGGGGCATGGAATGTCTTCCTGTCTGCCTGGCTTTTTCCCAG
TGGGAACTCTATGTCCCTCGTGATCAGTGTTACGCCCTGTCATCTGTGAGCTCTGGAACCTCCATTCAGA
ACTCCTCCCTGGTTGGCTGTACTCACCAAGGAAATGGCTTGCTCATCCCGTGTGGGAGTGGCCAAGCATC
TGACGGTGACTGTGACCATGCGCAACAGGCCTTAATCCAAATAGAAGCGAGTGCATGTGCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 87991. Forward Primer - name:087991_F_cDNA_1810041L15Rik, sequence:CAAACAGGGGTTAGAGGTCAAG; Reverse Primer - name:087991_N_SP6_cDNA_1810041L15Rik, sequence:GTGCACATGCACTCGCTTCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006325 same experiment
 EMAGE:30157 same embryo
 EMAGE:30167 same embryo
 EMAGE:30484 same embryo
 EMAGE:31601 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS