Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31643

Syncrip synaptotagmin binding, cytoplasmic RNA interacting protein ( MGI:1891690)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31643 EMAGE:31643 EMAGE:31643 EMAGE:31643 EMAGE:31643
euxassay_014187_01 euxassay_014187_02 euxassay_014187_03 euxassay_014187_04 euxassay_014187_05
EMAGE:31643 EMAGE:31643 EMAGE:31643 EMAGE:31643 EMAGE:31643
euxassay_014187_06 euxassay_014187_07 euxassay_014187_08 euxassay_014187_09 euxassay_014187_10
EMAGE:31643 EMAGE:31643 EMAGE:31643 EMAGE:31643 EMAGE:31643
euxassay_014187_11 euxassay_014187_12 euxassay_014187_13 euxassay_014187_14 euxassay_014187_15
EMAGE:31643 EMAGE:31643 EMAGE:31643 EMAGE:31643 EMAGE:31643
euxassay_014187_16 euxassay_014187_17 euxassay_014187_18 euxassay_014187_19 euxassay_014187_20
EMAGE:31643 EMAGE:31643 EMAGE:31643 EMAGE:31643
euxassay_014187_21 euxassay_014187_22 euxassay_014187_23 euxassay_014187_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 19
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 15 16 17
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 19 20
renal cortex
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 15 16 17 18
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 weak expression: see section 02 03 04
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38700
Entity Detected:Syncrip, synaptotagmin binding, cytoplasmic RNA interacting protein ( MGI:1891690)
Sequence:sense strand is shown

>T38700
ATTGCAGTGATACAGATGCCACTGTTGGTACCCTTAAATTTTTATTTCTGCTCACCAAGGTTAATCATGA
TTGTCTATATCTTTTTTATAGTAATCACTTTTGAATTGTGTTCAGATGCAGTTTCAGGTGTAATCATCAG
AGCTGGTTAGTCAGGCATTCCAGATAGTGGTTCTTTTCAGAACCTTTTTTAAAGGGTTGGTTAACTACCT
CAGTAGCAGAGGATTGAACTATACCCTGTCTGTACTGTACATAGAAAATCTTTGTAGATAAAAGCAAGGC
TTGTTAAATATGATATGAGGGTAAGATTTTAATATACCAAATGTAACATTCTTAGTTGCCTTTAGTTTCA
GAGGCTTGTAAGACTTCCTCATGACCATCATAACAGGCCTTGCTTTTGTCGTATTTTGTGGCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 159457. Forward Primer - name:159457_F_cDNA_Mm.211712, sequence:ATTGCAGTGATACAGATGCCAC; Reverse Primer - name:159457_N_SP6_cDNA_Mm.211712, sequence:CAGCCACAAAATACGACAAAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_014187 same experiment
 EMAGE:29928 same embryo
 EMAGE:29929 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS