Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31662

Pvalb parvalbumin ( MGI:97821)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31662 EMAGE:31662 EMAGE:31662 EMAGE:31662 EMAGE:31662
euxassay_000449_11 euxassay_000449_01 euxassay_000449_02 euxassay_000449_03 euxassay_000449_04
EMAGE:31662 EMAGE:31662 EMAGE:31662 EMAGE:31662 EMAGE:31662
euxassay_000449_05 euxassay_000449_06 euxassay_000449_07 euxassay_000449_08 euxassay_000449_09
EMAGE:31662 EMAGE:31662 EMAGE:31662 EMAGE:31662 EMAGE:31662
euxassay_000449_10 euxassay_000449_12 euxassay_000449_13 euxassay_000449_14 euxassay_000449_15
EMAGE:31662 EMAGE:31662 EMAGE:31662 EMAGE:31662 EMAGE:31662
euxassay_000449_16 euxassay_000449_17 euxassay_000449_18 euxassay_000449_19 euxassay_000449_20
EMAGE:31662 EMAGE:31662 EMAGE:31662 EMAGE:31662
euxassay_000449_21 euxassay_000449_22 euxassay_000449_23 euxassay_000449_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 20 21
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 19 weak expression: see section 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1778
Entity Detected:Pvalb, parvalbumin ( MGI:97821)
Sequence:sense strand is shown

>T1778
TGGCCTCGAGCCAGATTCGGCACGAGGGCCCAGCTTTTCTGTATAGGCTCCGGCCTCTGCTCATCCAAGT
TGCAGGATGTCGATGACAGACGTGCTCAGCGCTGAGGACATCAAGAAGGCGATAGGAGCCTTTGCTGCTG
CAGACTCCTTCGACCACAAAAAGTTCTTCCAGATGGTGGGCCTGAAGAAAAAGAACCCGGATGAGGTGAA
GAAGGTGTTCCATATTCTGGACAAAGACAAAAGTGGCTTCATTGAGGAGGATGAGCTGGGGTCCATTCTG
AAGGGCTTCTCCTCAGATGCCAGAGACTTGTCTGCTAAAGAAACAAAGACGCTTCTGGCCGCTGGAGACA
AGGATGGGGACGGCAAGATTGGGGTTGAAGAATTCTCCACTCTGGTGGCTGAAAGCTAAGTGGCGCTGAC
TGCTTGGGTCCCCCACCTCTCCATCCCCAACGCCCCATCTCAGTCCTTCTCGCGGCCCTCCTGAGTTTCT
GTTCAGTTTGTTTGTGTTATTTTTTACTCCCCCATCCTCTATGGCCCTCGGATGACG
Notes:The probe template was PCR amplified from IMAGE:493697 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:493697 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000449 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS