Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31697

Clca5 chloride channel calcium activated 5 ( MGI:2139758)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31697 EMAGE:31697 EMAGE:31697 EMAGE:31697 EMAGE:31697
euxassay_002878_01 euxassay_002878_02 euxassay_002878_03 euxassay_002878_04 euxassay_002878_05
EMAGE:31697 EMAGE:31697 EMAGE:31697 EMAGE:31697 EMAGE:31697
euxassay_002878_06 euxassay_002878_07 euxassay_002878_08 euxassay_002878_09 euxassay_002878_10
EMAGE:31697 EMAGE:31697 EMAGE:31697 EMAGE:31697 EMAGE:31697
euxassay_002878_11 euxassay_002878_12 euxassay_002878_13 euxassay_002878_14 euxassay_002878_15
EMAGE:31697 EMAGE:31697 EMAGE:31697 EMAGE:31697 EMAGE:31697
euxassay_002878_16 euxassay_002878_17 euxassay_002878_18 euxassay_002878_19 euxassay_002878_20
EMAGE:31697 EMAGE:31697
euxassay_002878_21 euxassay_002878_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 16 17 18 weak expression: see section 20 21
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 08 16 17 18
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 16 17 18
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 16 17 18
vibrissa
moderate moderate
regionalmoderate expression: see section 19 20 weak expression: see section 06 07 21
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 12 15
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 04 05 21 22 moderate expression: see section 06 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T227
Entity Detected:Clca5, chloride channel calcium activated 5 ( MGI:2139758)
Sequence:sense strand is shown

>T227
GTACCCAGCAGGCTCCCCGTGAATAAACCAGAGGTTTCACTGCAAGATGACCCACAGGGNACAGCACAGG
ACCTGTCATCGGGCTGAAACTTGTGACCCTTCTGTTCACCCTAAGTCCAGAACTTCTGTTCCTGGGAGCT
GGATTGAAGCTGAAAGAGAATGGCTATGATGGATTGCTTGTTGCCATCAATCCCCGGGTACCCGAGGATC
TGAAGCTGATTACAAACATTAAGGAAATGATAACCGAAGCTTCCTTTTACCTGTTCAATGCGACCAAGAG
GAGGGTGTTTTTCAGAAATGTACAGATTTTAGTACCTGCCACTTGGACGGATCATAATTACAGTAGAGTA
AGACAAGAATCCTATGACAAGGCAAATGTCATAGTGGCTGAGCAGAGTGAGGAACACGGAGATGATCCCT
ACACCCTACAGCACAGAGGGTGTGGGCAAGAGGGGAGATACATCCACTTCACCCCCAGCTTCCTACTCAA
CGATGAGTTAGCCGCAG
Notes:The probe template was PCR amplified from IMAGE:2650226 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2650226 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002878 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS