Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31723

St6galnac5 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5 ( MGI:1349471)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31723 EMAGE:31723 EMAGE:31723 EMAGE:31723 EMAGE:31723
euxassay_002840_01 euxassay_002840_02 euxassay_002840_03 euxassay_002840_04 euxassay_002840_05
EMAGE:31723 EMAGE:31723 EMAGE:31723 EMAGE:31723 EMAGE:31723
euxassay_002840_06 euxassay_002840_07 euxassay_002840_08 euxassay_002840_09 euxassay_002840_10
EMAGE:31723 EMAGE:31723 EMAGE:31723 EMAGE:31723 EMAGE:31723
euxassay_002840_11 euxassay_002840_12 euxassay_002840_13 euxassay_002840_14 euxassay_002840_15
EMAGE:31723 EMAGE:31723 EMAGE:31723 EMAGE:31723 EMAGE:31723
euxassay_002840_16 euxassay_002840_17 euxassay_002840_18 euxassay_002840_19 euxassay_002840_20
EMAGE:31723 EMAGE:31723 EMAGE:31723
euxassay_002840_21 euxassay_002840_22 euxassay_002840_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 16 17 18
metencephalon basal plate
moderate moderate
regionalmoderate expression: see section 07
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 09 10 11 12 13 17 18 19 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 22
medulla oblongata basal plate
moderate moderate
regionalmoderate expression: see section 08 09 10 16 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 moderate expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 moderate expression: see section 11 16 21 22 23
telencephalon marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 moderate expression: see section 11 12 13 14 15 16 17 18 19 20 21 22 23
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 11 12 13 14 15 16 18 19 20 21
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 14 15 16 18 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2111
Entity Detected:St6galnac5, ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5 ( MGI:1349471)
Sequence:sense strand is shown

>T2111
TGGCCTCGAGNCAGATTCGGACGAGGGGCAGCCAGAAGGAGCGGCCCCCGCAGCAGCAGCAGCAGCAGCA
GCAGCAGCAGCAGGCGGCAACCGCGACTGGCAGCACGCAGCTTGTGGAGAGCAGTCCCCAGCCACGTAGA
ACCGCCCCCGCAGGACCCCGGCAGCTCGAAGGATACCTCGGTGTAGCAGACCACAAGCCCCTGAAAATGC
ATTGCAAGGATTGCGCCCTGGTGACCAGCTCAGGGCATCTGCTGCGTAGTCAGCAGGGCCCCCACATCGA
CCAGACAGAGTGTGTTATCCGCATGAATGATGCCCCCACCCGAGGCTATGGGCTTGACGTGGGCAACCGC
ACGAGCCTGCGGGTCATCGCACATTCCAGCATCCAGAGGATCCTCCGCAACCGCCATGACCTGCTCAATG
TGAGCCAGGGCACCGTGTTCATCTTCTGGGGCCCCAGCAGCTACATGCGCCGGGATGGCAAGGGCCAGGC
GTACAACAACCTACAGCTCCTTAGCCAAGTGCTGCCTCGGCTGAAGGCCTTC
Notes:The probe template was PCR amplified from IMAGE:851226 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:851226 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002840 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS