Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31735

Arl5a ADP-ribosylation factor-like 5A ( MGI:1922673)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31735 EMAGE:31735 EMAGE:31735 EMAGE:31735 EMAGE:31735
euxassay_002854_01 euxassay_002854_02 euxassay_002854_03 euxassay_002854_04 euxassay_002854_05
EMAGE:31735 EMAGE:31735 EMAGE:31735 EMAGE:31735 EMAGE:31735
euxassay_002854_06 euxassay_002854_07 euxassay_002854_08 euxassay_002854_09 euxassay_002854_10
EMAGE:31735 EMAGE:31735 EMAGE:31735 EMAGE:31735 EMAGE:31735
euxassay_002854_11 euxassay_002854_12 euxassay_002854_13 euxassay_002854_14 euxassay_002854_15
EMAGE:31735 EMAGE:31735 EMAGE:31735 EMAGE:31735 EMAGE:31735
euxassay_002854_16 euxassay_002854_17 euxassay_002854_18 euxassay_002854_19 euxassay_002854_20
EMAGE:31735 EMAGE:31735 EMAGE:31735
euxassay_002854_21 euxassay_002854_22 euxassay_002854_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 08 09 10 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 02 03 18
medulla oblongata basal plate
moderate moderate
regionalmoderate expression: see section 07 14 weak expression: see section 06 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 15 16 17 18 20 weak expression: see section 19
vibrissa
moderate moderate
regionalmoderate expression: see section 01 02 03 16 17 18
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 15 16 17
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 16 17 weak expression: see section 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1579
Entity Detected:Arl5a, ADP-ribosylation factor-like 5A ( MGI:1922673)
Sequence:sense strand is shown

>T1579
CAGAAATCTCCCAGTTTTTGAAGCTTACTTCTATAAAAGACCACCAGTGGCATATTCAAGCATGTTGCGC
TCTTACTGGCGAGGGGTTATGCCAAGGACTTGAATGGATGATGTCACGGCTGAAGATCAGATGATCTCTT
CTGACCCCTCCTCACAGACTCTGTATAAAGAAAGTGCTGGACTTTTCCTGAAAGCTGCAAAAAAATGGTT
TAGATATATTTATAATAAACTGACTTAAGAGTTTTCTATAAGAAGAAAATTAAGACCACTTATTTGAAAA
CAAAGATGAAATGTCACCACCCGTTTGCGCTCTCATTCCTTCCAAGCCTGTGACTGGTATTTTCTCATGA
TGAATCCTCTCAGGACATGGCAGAGCTTGGCGAGTACAAAGGGAGAGGAAGACATTTGAACTTTAGAACT
TTGTTTCAGCGTGACTCTCCCACCCTGCCCCAAGTTGAATGTTCCCTTCACATTGAATCAAATACAAATC
AGCACAGATACTGTTTCCAGTTTTTAAAAA
Notes:The probe template was PCR amplified from IMAGE:934823 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:934823 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002854 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS