Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31737

Angptl4 angiopoietin-like 4 ( MGI:1888999)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31737 EMAGE:31737 EMAGE:31737 EMAGE:31737 EMAGE:31737
euxassay_002853_01 euxassay_002853_02 euxassay_002853_03 euxassay_002853_04 euxassay_002853_05
EMAGE:31737 EMAGE:31737 EMAGE:31737 EMAGE:31737 EMAGE:31737
euxassay_002853_06 euxassay_002853_07 euxassay_002853_08 euxassay_002853_09 euxassay_002853_10
EMAGE:31737 EMAGE:31737 EMAGE:31737 EMAGE:31737 EMAGE:31737
euxassay_002853_11 euxassay_002853_12 euxassay_002853_13 euxassay_002853_14 euxassay_002853_15
EMAGE:31737 EMAGE:31737 EMAGE:31737 EMAGE:31737 EMAGE:31737
euxassay_002853_16 euxassay_002853_17 euxassay_002853_18 euxassay_002853_19 euxassay_002853_20
EMAGE:31737 EMAGE:31737 EMAGE:31737 EMAGE:31737
euxassay_002853_21 euxassay_002853_22 euxassay_002853_23 euxassay_002853_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
spinal cord meninges
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19
midbrain meninges
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
rib
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 20 21 22 23 24
diencephalon meninges
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
cochlear duct
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 19 20 21 22
axial musculature
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 23 24
hindbrain meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1072
Entity Detected:Angptl4, angiopoietin-like 4 ( MGI:1888999)
Sequence:sense strand is shown

>T1072
TCCTCGAGACTGTTGGCCCACTGGGAACGCTTATGAGCTACGGGCTCCAGATCTTCTTCTGCACCTGAGC
AAGTCTAAGTCTGAGCCGGCTCCCCCAGAACTCCAGCTGCTGGGTCTTGAACTCCTGCGTTCCGGAGTCC
TAGCGTTGCTGCACCCAAGGCCACCCCCAGAATCATGCGCTGCGCTCCGACAGCAGGCGCTGCCCTGGTG
CTATGCGCGGCTACTGCGGGGCTTTTGAGCGCGCAAGGGCGCCCTGCACAGCCAGAGCCACCGCGCTTTG
CATCCTGGGACGAGATGAACTTGCTGGCTCACGGGCTGCTACAGCTCGGCCATGGGCTGCGCGAACACGT
GGAGCGCACCCGTGGGCAGCTGGGCGCGCTGGAGCGCCGCATGGCTGCCTGTGGTAACGCTTGTCAGGGG
CCCAAGGGAAAAGATGCACCCTTCAAAGACTCCGAGGATAGAGTCCCTGAAGGCCAGACTCCTGAGACTC
TGCAGAGTTTGCAGACTCAGCTCAAGGCTCAAAACAGCAAGATCCAGCAATTGTTCCAGAAGGTGGCCCA
GCAGCAGAGATACCTATCAAAGCA
Notes:The probe template was PCR amplified from IMAGE:2099753 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2099753 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002853 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS