Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31740

Iffo1 intermediate filament family orphan 1 ( MGI:2444516)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31740 EMAGE:31740 EMAGE:31740 EMAGE:31740 EMAGE:31740
euxassay_002852_01 euxassay_002852_02 euxassay_002852_03 euxassay_002852_04 euxassay_002852_05
EMAGE:31740 EMAGE:31740 EMAGE:31740 EMAGE:31740 EMAGE:31740
euxassay_002852_06 euxassay_002852_07 euxassay_002852_08 euxassay_002852_09 euxassay_002852_10
EMAGE:31740 EMAGE:31740 EMAGE:31740 EMAGE:31740 EMAGE:31740
euxassay_002852_11 euxassay_002852_12 euxassay_002852_13 euxassay_002852_14 euxassay_002852_15
EMAGE:31740 EMAGE:31740 EMAGE:31740 EMAGE:31740 EMAGE:31740
euxassay_002852_16 euxassay_002852_17 euxassay_002852_18 euxassay_002852_19 euxassay_002852_20
EMAGE:31740 EMAGE:31740
euxassay_002852_21 euxassay_002852_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 16 17 18 19 20 21 22
hand mesenchyme
strong strong
regionalstrong expression: see section 02 03 04
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
tail mesenchyme
strong strong
regionalstrong expression: see section 14 15 16
head mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 16 17 18 19 20 21 22
foot mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 20 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2276
Entity Detected:Iffo1, intermediate filament family orphan 1 ( MGI:2444516)
Sequence:sense strand is shown

>T2276
TGGCCTCGAGCCAGATTCGTCGACAGGACAGATAGAGCTGGAGCTGGCCACAGCCAAGAACGACATGAAC
CGACACCTGCATGAGTACATGGAGATGTGCAGCATGAAGCGGGGCCTGGACGTGCAGATGGAGACCTGCC
GCCGGCTCATCACACAGTCCGGGGACCGAAAGTCTCCTGCTTTCACTGCGGTCCCGCTTAGCGACCCGCC
GCCACCGCCGAGTGAGACTGAGGACTCCGATCGAGACGTCTCATCTGATAGCTCCATGAGATAGAAACCA
GTGTCTGGCACCCCAGAGCTCACTGGGGCAGGGGTGTGGGTCTGCAGGGGTGTGGGTCTTCTGTGCCACT
GCATGAAGCCTGGCCCTGGGCTGTCCCTCCCCAGGTTCTGGGGTGTCTGGAGCTAGGCTCAGCCCCACCC
TCCCTGTACAACGCCCATGACATTGGGACACTCCTTCCTGCCTTCCTCACATGTGGGTATCTGCTACTTC
TCCATCTTCGGAATGCTGCCAGGACACTTGTGAGCCTCCCTTTTCCACTTTGTAAGG
Notes:The probe template was PCR amplified from IMAGE:1094885 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1094885 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002852 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS