Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31741

Hoxa6 homeobox A6 ( MGI:96178)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31741 EMAGE:31741 EMAGE:31741 EMAGE:31741 EMAGE:31741
euxassay_002858_01 euxassay_002858_02 euxassay_002858_03 euxassay_002858_04 euxassay_002858_05
EMAGE:31741 EMAGE:31741 EMAGE:31741 EMAGE:31741 EMAGE:31741
euxassay_002858_06 euxassay_002858_07 euxassay_002858_08 euxassay_002858_09 euxassay_002858_10
EMAGE:31741 EMAGE:31741 EMAGE:31741 EMAGE:31741 EMAGE:31741
euxassay_002858_11 euxassay_002858_12 euxassay_002858_13 euxassay_002858_14 euxassay_002858_15
EMAGE:31741 EMAGE:31741 EMAGE:31741 EMAGE:31741 EMAGE:31741
euxassay_002858_16 euxassay_002858_17 euxassay_002858_18 euxassay_002858_19 euxassay_002858_20
EMAGE:31741 EMAGE:31741 EMAGE:31741 EMAGE:31741
euxassay_002858_21 euxassay_002858_22 euxassay_002858_23 euxassay_002858_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
spinal cord
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 13 14 weak expression: see section 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5313
Entity Detected:Hoxa6, homeobox A6 ( MGI:96178)
Sequence:sense strand is shown

>T5313
AGGACTCCTTCTTGGGCCAGCTGCCCCTCTACCCGGCCGGCTATGACGCGCTGAGGCCCTTCCCGGCCTC
TTACGGGGCGTCGAGTCTTCCGGACAAGACATACACCTCACCTTGTTTTTACCAACAGTCCAACTCGGTC
TTGGCCTGCAACCGGGCATCCTACGAGTACGGGGCCTCATGTTTCTATTCTGATAAAGACCTCAGTGGCG
CCTCACCCTCGGGCAATAACAAGCAGAGGGGCCCCGGGGACTACCTGCACTTTTCTCCCGAGCAGCAGTA
CAAACCTGACGGCAGCGTGCAGGGCAAAGCCCTCCATGAGGAAGGCACCGACCGGAAGTACACAA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers.. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002858 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS