Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31743

Hoxa13 homeobox A13 ( MGI:96173)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31743 EMAGE:31743 EMAGE:31743 EMAGE:31743 EMAGE:31743
euxassay_002857_01 euxassay_002857_02 euxassay_002857_03 euxassay_002857_04 euxassay_002857_05
EMAGE:31743 EMAGE:31743 EMAGE:31743 EMAGE:31743 EMAGE:31743
euxassay_002857_06 euxassay_002857_07 euxassay_002857_08 euxassay_002857_09 euxassay_002857_10
EMAGE:31743 EMAGE:31743 EMAGE:31743 EMAGE:31743 EMAGE:31743
euxassay_002857_11 euxassay_002857_12 euxassay_002857_13 euxassay_002857_14 euxassay_002857_15
EMAGE:31743 EMAGE:31743 EMAGE:31743 EMAGE:31743 EMAGE:31743
euxassay_002857_16 euxassay_002857_17 euxassay_002857_18 euxassay_002857_19 euxassay_002857_20
EMAGE:31743 EMAGE:31743 EMAGE:31743
euxassay_002857_21 euxassay_002857_22 euxassay_002857_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 22
foot dermis
strong strong
regionalstrong expression: see section 05 06 07 08 09 18 19 20 21 22 moderate expression: see section 03 04 23
hand dermis
strong strong
regionalstrong expression: see section 05 06 07 08 moderate expression: see section 01 02 03 04 23
glans of male genital tubercle
strong strong
regionalstrong expression: see section 13 14 15 weak expression: see section 12
male reproductive system
weak weak
regionalweak expression: see section 15
urethra of male
strong strong
regionalstrong expression: see section 13 14 weak expression: see section 15
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 21 22
bladder
moderate moderate
regionalmoderate expression: see section 13 14 15 weak expression: see section 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5309
Entity Detected:Hoxa13, homeobox A13 ( MGI:96173)
Sequence:sense strand is shown

>T5309
CCGGCTACCTGGATATGCCAGTAGTTCCGGGGCTCGGGGGTCCTGGCGAGTCGCGCCACGAGCCTCTGGG
GCTTCCCATGGAAAGCTATCAGCCCTGGGCTCTGCCCAACGGCTGGAACGGCCAAATGTACTGCCCCAAA
GAGCAGACGCAGCCTCCCCACCTCTGGAAGTCCACTCTGCCCGACGTCGTCTCCCATCCTTCAGACGCCA
GCTCCTATAGGAGGGGGAGAAAGAAGCGCGTGCCTTACACTAAGGTGCAGTTGAAAGAACTCGAACGGGA
ATACGCTACGAACAAATTCATTACCAAGGACAAACGGAGGAGGATATCAGCCACGACAAACCTCTCTGAG
AGGCAGGTCACAATCTGGTTCCAGAACAGGAGGGTCAAAGAGAAAAAAGTCATCAATAAACTC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers.. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002857 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS