Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31744

Enpp2 ectonucleotide pyrophosphatase/phosphodiesterase 2 ( MGI:1321390)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31744 EMAGE:31744 EMAGE:31744 EMAGE:31744 EMAGE:31744
euxassay_002856_01 euxassay_002856_02 euxassay_002856_03 euxassay_002856_04 euxassay_002856_05
EMAGE:31744 EMAGE:31744 EMAGE:31744 EMAGE:31744 EMAGE:31744
euxassay_002856_06 euxassay_002856_07 euxassay_002856_08 euxassay_002856_09 euxassay_002856_10
EMAGE:31744 EMAGE:31744 EMAGE:31744 EMAGE:31744 EMAGE:31744
euxassay_002856_11 euxassay_002856_12 euxassay_002856_13 euxassay_002856_14 euxassay_002856_15
EMAGE:31744 EMAGE:31744 EMAGE:31744 EMAGE:31744 EMAGE:31744
euxassay_002856_16 euxassay_002856_17 euxassay_002856_18 euxassay_002856_19 euxassay_002856_20
EMAGE:31744 EMAGE:31744 EMAGE:31744 EMAGE:31744
euxassay_002856_21 euxassay_002856_22 euxassay_002856_23 euxassay_002856_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 23
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 05 06 07 08 22 23 24
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 05 06 07 08 23 24
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 11 21 23 24
clavicle
moderate moderate
regionalmoderate expression: see section 13 14 16 17 18
male reproductive system
strong strong
regionalstrong expression: see section 14 18
4th ventricle lateral recess
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 05 07 08 23 24
trachea
strong strong
regionalstrong expression: see section 13 14 15 16
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 06 07 10 11 21 23 24
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 21 22 23 24
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17
pectoral girdle and thoracic body wall muscle
strong strong
regionalstrong expression: see section 14 15 16 17 18 19
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
larynx
strong strong
regionalstrong expression: see section 15 16
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 05 07 22 23
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 13 14
kidney calyx
strong strong
regionalstrong expression: see section 09 10 11 12 13 19 20 21 22 23
pons ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18
foot mesenchyme
strong strong
regionalstrong expression: see section 02 03 04
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 05 06 09 10 21 22 23 24
hand mesenchyme
strong strong
regionalstrong expression: see section 02 03 04
lower jaw incisor
strong strong
regionalstrong expression: see section 12 13 14 15 17 18
upper jaw incisor
strong strong
regionalstrong expression: see section 13 14 15 18 19
glans of male genital tubercle
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2360
Entity Detected:Enpp2, ectonucleotide pyrophosphatase/phosphodiesterase 2 ( MGI:1321390)
Sequence:sense strand is shown

>T2360
GNCCTCGAGGCCAGATTCGGCACGAGGAACTGTTTAGCCTATAAAAATGATAAACAGATGTCCTATGGAT
TCCTTTTTCCTCCCTATCTGAGCTCTTCCCCAGAAGCGAAATATGATGCATTCCTTGTAACCAACATGGT
TCCAATGTACCCTGCCTTCAAACGTGTTTGGACTTATTTCCAAAGGGTCTTGGTGAAGAAATATGCGTCA
GAAAGGAATGGGGTCAACGTAATAAGTGGACCGATCTTTGACTACAATTACAATGGCTTACGTGACATTG
AGGATGAAATTAAACAGTATGTGGAAGGCAGCTCTATTCCTGTCCCTACCCACTACTACAGCATCATCAC
CAGCTGCCTGGACTTCACTCAGCCTGCAGACAAGTGTGATGGTCCTCTCTCTGTGTCTTCTTTCATCCTT
CCTCACCGACCTGACAATGATGAGAGCTGTAATAGTTCCGAGGATGAGTCGAAGTGGGTAGAGGAACTCA
TGAAGATGCACACAGCTCGGGTGAGGGACATCGAGCATCTCACCGGTTTGGATTTCTACCGGAAGACTAG
CCGTAGCTATTCG
Notes:The probe template was PCR amplified from IMAGE:1179261 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1179261 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002856 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS