Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31746

Ednrb endothelin receptor type B ( MGI:102720)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31746 EMAGE:31746 EMAGE:31746 EMAGE:31746 EMAGE:31746
euxassay_002855_01 euxassay_002855_02 euxassay_002855_03 euxassay_002855_04 euxassay_002855_05
EMAGE:31746 EMAGE:31746 EMAGE:31746 EMAGE:31746 EMAGE:31746
euxassay_002855_06 euxassay_002855_07 euxassay_002855_08 euxassay_002855_09 euxassay_002855_10
EMAGE:31746 EMAGE:31746 EMAGE:31746 EMAGE:31746 EMAGE:31746
euxassay_002855_11 euxassay_002855_12 euxassay_002855_13 euxassay_002855_14 euxassay_002855_15
EMAGE:31746 EMAGE:31746 EMAGE:31746 EMAGE:31746 EMAGE:31746
euxassay_002855_16 euxassay_002855_17 euxassay_002855_18 euxassay_002855_19 euxassay_002855_20
EMAGE:31746 EMAGE:31746
euxassay_002855_21 euxassay_002855_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
heart ventricle
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
midbrain meninges
strong strong
regionalstrong expression: see section 17
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 04 06 07 08 09 17 18 19 20
rectum
strong strong
regionalstrong expression: see section 13 14
male reproductive system
strong strong
regionalstrong expression: see section 14
4th ventricle lateral recess
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 moderate expression: see section 12 13 14 15 16 17 18 19 20 21 22
nose
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 18 19 20 21 22
midgut loop
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
bladder
moderate moderate
regionalmoderate expression: see section 13 14 15
esophagus
strong strong
regionalstrong expression: see section 13 14 15
facial vii ganglion
strong strong
regionalstrong expression: see section 05 21 22
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 16 17 18 19 20 21 22
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 17 18 19 20 21 22
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16
hindgut
strong strong
regionalstrong expression: see section 13 14 15 16 17
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 06 07 08 09 10 moderate expression: see section 13 14 15 16 17 18 19
midbrain mantle layer
strong strong
single cellstrong expression: see section 08 16 17
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 15 16 17
ventral grey horn
strong strong
single cellstrong expression: see section 10 11 12 13 14 15 16 17
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17
stomach
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 moderate expression: see section 02
tongue
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17
pons ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
urethra of male
strong strong
regionalstrong expression: see section 13 14
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 09 18 19
pons mantle layer
strong strong
regionalstrong expression: see section 06 19
midgut
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 13 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 15 16 17 18 19
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 07 08 09 10 11 12 14 15 16 17 18
heart
moderate moderate
regionalmoderate expression: see section 07
tail mesenchyme
strong strong
regionalstrong expression: see section 11 12 13 14 15
tail
strong strong
regionalstrong expression: see section 15
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 07 08 09 10 11 14 15 16 17
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1064
Entity Detected:Ednrb, endothelin receptor type B ( MGI:102720)
Sequence:sense strand is shown

>T1064
GTTGGCCTACTGGGACTGAATGCAGACCAGCGGGTGGCGTGCGCCCAAGTTCCCCACTGGCGCGCAAACT
TAACTTACTGTTAAGGCGCGGGTAGAGGCAACCGGGCTAGTGTGTTTTCAGAGGCTTGGCTGGGGTAGCT
GACTTAAGTGTCCTGTCTTCACTCCCCAGTTGGTCTCCAGACTGAAAACAGCAGAGCGGCTACCAGACTC
TCACAGGAGCAAGCTGTAACATGCAATCGCCCGCAAGCCGGTGCGGACGCGCCTTGGTGGCGCTGCTGCT
GGCCTGTGGCTTCTTGGGGGTATGGGGAGAGAAAAGAGGATTCCCACCTGCCCAAGCCACGCTGTCACTT
CTCGGGACTAAAGAGGTAATGACGCCACCCACTAAGACCTCCTGGACCAGAGGTTCCAACTCCAGTCTGA
TGCGTTCCTCCGCACCTGCGGAGGTGACCAAAGGAGGGAGGGGGGCTGGAGTCCCGCCAAGATCCTTCCC
TCCTCCGTGCCAACGAAATATTGAGATCAGCAAGACTTTTAAATACATCAACACGATTGTGTCGTGCC
Notes:The probe template was PCR amplified from IMAGE:2099487 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2099487 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002855 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS