Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31747

Ogn osteoglycin ( MGI:109278)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31747 EMAGE:31747 EMAGE:31747 EMAGE:31747 EMAGE:31747
euxassay_002859_01 euxassay_002859_02 euxassay_002859_03 euxassay_002859_04 euxassay_002859_05
EMAGE:31747 EMAGE:31747 EMAGE:31747 EMAGE:31747 EMAGE:31747
euxassay_002859_06 euxassay_002859_07 euxassay_002859_08 euxassay_002859_09 euxassay_002859_10
EMAGE:31747 EMAGE:31747 EMAGE:31747 EMAGE:31747 EMAGE:31747
euxassay_002859_11 euxassay_002859_12 euxassay_002859_13 euxassay_002859_14 euxassay_002859_15
EMAGE:31747 EMAGE:31747 EMAGE:31747 EMAGE:31747 EMAGE:31747
euxassay_002859_16 euxassay_002859_17 euxassay_002859_18 euxassay_002859_19 euxassay_002859_20
EMAGE:31747
euxassay_002859_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
mandible
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 11 13 14 15 16 17 18 19 20 21
thoracic intervertebral disc
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
lumbar intervertebral disc
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21
rectum
strong strong
regionalstrong expression: see section 12 13 14
foot mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 21
4th ventricle lateral recess
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 20 moderate expression: see section 03 04 05 18 19
nose
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 14 15 16 17 18
body-wall mesenchyme
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 15 16 17 18 19 20 21
tongue muscle
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
midgut
strong strong
regionalstrong expression: see section 13 14 15 16 17
midgut loop
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
premaxilla
moderate moderate
regionalmoderate expression: see section 09 11 14 16
otic capsule
strong strong
regionalstrong expression: see section 06 07 08 09 15 16 17 18 19 20
diaphragm
strong strong
regionalstrong expression: see section 08 09 10 13 14 15 16 moderate expression: see section 11 12 weak expression: see section 05 06 07 17
hand mesenchyme
strong strong
regionalstrong expression: see section 01 02 03
vertebral axis musculature
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 18 19 20 21
cervical intervertebral disc
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
hindgut
strong strong
regionalstrong expression: see section 12 13 14 15 16 17
upper lip
strong strong
regionalstrong expression: see section 10 11 12 14 15 16
sacral vertebral cartilage condensation
strong strong
regionalstrong expression: see section 11 12 13 14 15
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 moderate expression: see section 05 19
nasal septum
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2191
Entity Detected:Ogn, osteoglycin ( MGI:109278)
Sequence:sense strand is shown

>T2191
TGGCCTCGAGGCCAGATTCGGATCCTTGTCCAAGCTTACTTTACTTAATGCCAAACACAACAAAATCAAG
AGTAAAGGAATTAAAGCAAACACATTCAAAAAACTGAATAAACTCTCTTTTCTCTATTTGGACCATAACG
ACCTGGAATCTGTGCCTCCTAATTTACCAGAAAGTCTACGTGTAATTCACCTTCAGTTTAACAGCATATC
TTCACTTACAGATGATACATTCTGCAAGGCTAATGACACTCGTTACATTCGGGAGCGAATTGAAGAGATT
CGCCTGGAGGGCAATCCAATTGCTCTGGGAAAGCATCCAAACAGTTTTATCTGCTTAAAAAGATTACCCA
TAGGGTCATACTTCTAACCCCATCAGTGCAGCTTATAACCTAAGGTACATGTGCCTAATGTCTAAAGGAA
CAGAAACATTAGTTTAACATTACCGTTTTATCTCACTATGATGGAAGTTTATGTTTAAACAAAGTGTCCA
AAATTGTTGTATGTGACTACAAAAATAATCCAGCCTGAATCTCTTAGTTCAAAA
Notes:The probe template was PCR amplified from IMAGE:902626 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:902626 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002859 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS