Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31759

Cdh9 ( MGI:107433)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31759 EMAGE:31759 EMAGE:31759 EMAGE:31759 EMAGE:31759
euxassay_009005_01 euxassay_009005_02 euxassay_009005_03 euxassay_009005_04 euxassay_009005_05
EMAGE:31759 EMAGE:31759 EMAGE:31759 EMAGE:31759 EMAGE:31759
euxassay_009005_06 euxassay_009005_07 euxassay_009005_08 euxassay_009005_09 euxassay_009005_10
EMAGE:31759 EMAGE:31759 EMAGE:31759 EMAGE:31759 EMAGE:31759
euxassay_009005_11 euxassay_009005_12 euxassay_009005_13 euxassay_009005_14 euxassay_009005_15
EMAGE:31759 EMAGE:31759 EMAGE:31759
euxassay_009005_16 euxassay_009005_17 euxassay_009005_18

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 05 11 moderate expression: see section 06 07 08 09 10
corpus striatum
moderate moderate
single cellmoderate expression: see section 04 05 17 18 weak expression: see section 16
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 13 14 weak expression: see section 03 04 10 12
ventral grey horn
strong strong
regionalstrong expression: see section 07 10 moderate expression: see section 06 08 weak expression: see section 09
diencephalon lateral wall mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 10
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 09 10 11 moderate expression: see section 03 12 13 weak expression: see section 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36141
Entity Detected:Cdh9, ( MGI:107433)
Sequence:sense strand is shown

>T36141
TGAAATGTCTGGAGTTGGTACGTCTGTTATACAAGTAACTGCCACCGATGCAGATGATGCTAACTATGGG
AACAGTGCTAAAGTGGTCTACAGCATTCTGCAAGGGCAGCCATACTTTTCAGTGGACCCGGAATCAGGCA
TAATAAAGACTGCATTGCCAGACATGAGCAGAGAAAACAAAGAGCAGTACCAAGTTGTTATTCAGGCTAA
GGACATGGGTGGCCAGATGGGAGGCCTCTCTGGCACCACCACAGTGAACATCACCCTAACAGATGTCAAC
AACAACCCTCCTCGGTTCCCACAGAGCACTTATCAGTTTAATTCTCTGGAGTCGGCACCTCTTGGAACTC
ATCTTGGAAGGATAAAAGCCAATGACCCAGACATGGGGGAGAACGCCGAGCTGGAATATAGCATTGCAGA
AGGAGAAGGATCAGACATGTTTGATGTGATCACTGACAAAGATACACAGGAAGGGATCATAACTGTCAAA
CAGAATTTAGATTTTGAAAAGAAAATGTTGTACACTTTAAGAGTGGATGCAAGTAATACCCACCCTGATC
CTCGATTCTTACACCTTGGACCTTTCAAAGACTCAGCCATGGTTAAGATATCTGTGGAAGATGTAGATGA
GCCCCCTGTGTTCAGTAAGCTCTCTTACTTGATGGAAGTTGATGAAGATGTGAAGGAGGGGAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 84991. Forward Primer - name:084991_F_cDNA_Cdh9, sequence:TGAAATGTCTGGAGTTGGTACG; Reverse Primer - name:084991_N_SP6_cDNA_Cdh9, sequence:GCTCCCCTCCTTCACATCTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009005 same experiment
 EMAGE:31714 same embryo
 EMAGE:30553 same embryo
 EMAGE:31751 same embryo
 EMAGE:31761 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS