Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31768

Hp ( MGI:96211)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31768 EMAGE:31768 EMAGE:31768 EMAGE:31768 EMAGE:31768
euxassay_000646_01 euxassay_000646_02 euxassay_000646_03 euxassay_000646_04 euxassay_000646_05
EMAGE:31768 EMAGE:31768 EMAGE:31768 EMAGE:31768 EMAGE:31768
euxassay_000646_06 euxassay_000646_07 euxassay_000646_08 euxassay_000646_09 euxassay_000646_10
EMAGE:31768 EMAGE:31768 EMAGE:31768 EMAGE:31768 EMAGE:31768
euxassay_000646_11 euxassay_000646_12 euxassay_000646_13 euxassay_000646_14 euxassay_000646_15
EMAGE:31768 EMAGE:31768 EMAGE:31768 EMAGE:31768 EMAGE:31768
euxassay_000646_16 euxassay_000646_17 euxassay_000646_18 euxassay_000646_19 euxassay_000646_20
EMAGE:31768 EMAGE:31768 EMAGE:31768 EMAGE:31768
euxassay_000646_21 euxassay_000646_22 euxassay_000646_23 euxassay_000646_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
adrenal gland
strong strong
homogeneousstrong expression: see section 01 10 11 12 18 19
liver lobe
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T888
Entity Detected:Hp, ( MGI:96211)
Sequence:sense strand is shown

>T888
ANGGTCCCGATGAGAGCCCTGGGAGCTGTTGTCACTCTCCTGCTCTGGGGTCAGCTTTTTGCTGTGGAGT
TGGGCAATGATGCCATGGACTTTGAAGATGACAGCTGCCCAAAGCCCCCAGAGATTGCAAACGGCTATGT
GGAGCACTTGGTTCGCTATCGCTGCCGACAGTTCTACAGACTACGGGCCGAAGGAGATGGGGTGTACACC
TTAAACGACGAGAAGCAATGGGTGAACACAGTCGCTGGAGAGAAACTCCCCGAATGTGAGGCAGTGTGTG
GGAAGCCCAAGCACCCTGTGGACCAGGTGCAGCGCATCATCGGTGGCTCTATGGATGCCAAAGGCAGCTT
TCCTTGGCAGGCCAAGATGATCTCCCGCCACGGACTCACCACCGGGGCCACGTTGATCAGTGACCAGTGG
CTGCTGACCACGGCCAAAAACCTCTTCCTGAACCACAGCGAGACGGCGTCAGCCAAGGACATCACCCCCA
CCCTAACG
Notes:The probe template was PCR amplified from IMAGE:1924108 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1924108 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000646 same experiment
 EMAGE:30208 same embryo
 EMAGE:30801 same embryo
 EMAGE:29184 same embryo
 EMAGE:31772 same embryo
 EMAGE:30601 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS