Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31792

Mfap5 ( MGI:1354387)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31792 EMAGE:31792 EMAGE:31792 EMAGE:31792 EMAGE:31792
euxassay_009215_01 euxassay_009215_02 euxassay_009215_03 euxassay_009215_04 euxassay_009215_05
EMAGE:31792 EMAGE:31792 EMAGE:31792 EMAGE:31792 EMAGE:31792
euxassay_009215_06 euxassay_009215_07 euxassay_009215_08 euxassay_009215_09 euxassay_009215_10
EMAGE:31792 EMAGE:31792 EMAGE:31792 EMAGE:31792 EMAGE:31792
euxassay_009215_11 euxassay_009215_12 euxassay_009215_13 euxassay_009215_14 euxassay_009215_15
EMAGE:31792 EMAGE:31792 EMAGE:31792 EMAGE:31792 EMAGE:31792
euxassay_009215_16 euxassay_009215_17 euxassay_009215_18 euxassay_009215_19 euxassay_009215_20
EMAGE:31792 EMAGE:31792 EMAGE:31792 EMAGE:31792 EMAGE:31792
euxassay_009215_21 euxassay_009215_22 euxassay_009215_23 euxassay_009215_24 euxassay_009215_25
EMAGE:31792
euxassay_009215_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
esophagus
weak weak
regionalweak expression: see section 09 10 11
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 15 16 17 18 19 20 21 22 23 24 25 26 weak expression: see section 04 05 06 07 11 12 13 14
aorta
moderate moderate
regionalmoderate expression: see section 07 08 09 weak expression: see section 10 11 12
extrinsic ocular muscle
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 21 22 23 24 25 26
bladder
weak weak
regionalweak expression: see section 15 16 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2568
Entity Detected:Mfap5, ( MGI:1354387)
Sequence:sense strand is shown

>T2568
TGGCCTCGAGCCAGATTCGGACGAGGTTNCTAATGAGATCTGTTCCCGACTCGTNTGTCAAGAACATGAA
GCTATGAAAGATGAGCTTTGCCGGCAGATGGCAGGCCTGCCTCCAAGGCGACTTCGGCGCTCCAACTACT
TCCGACTTCCTCCCTGTGAAAATATGAATTTGCAGAGACCCGATGGTCTGTGATCACCAAGGAAGAAAGA
AGAAAATGTGGATGAAGGAATCGAAAATTCTTTCTCCTCCAACCCCTGCCATCTGTCCCGTAGACATGTA
TTTTTAAACTAAGCCCTTTGCAATGCCCCGGCTTCCTACCCTACTCTAATTTTCACTGGTGCTGGTAACG
TTTGTCTCATTTTGCGGTACTGACAATACATTGTCTATATTGTGAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1382932 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1382932 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009215 same experiment
 EMAGE:31825 same embryo
 EMAGE:30054 same embryo
 EMAGE:30056 same embryo
 EMAGE:31789 same embryo
 EMAGE:29713 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS