Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31805

Tlx2 T-cell leukemia, homeobox 2 ( MGI:1350935)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31805 EMAGE:31805 EMAGE:31805 EMAGE:31805 EMAGE:31805
euxassay_019492_01 euxassay_019492_02 euxassay_019492_03 euxassay_019492_04 euxassay_019492_05
EMAGE:31805 EMAGE:31805 EMAGE:31805 EMAGE:31805 EMAGE:31805
euxassay_019492_06 euxassay_019492_07 euxassay_019492_08 euxassay_019492_09 euxassay_019492_10
EMAGE:31805 EMAGE:31805 EMAGE:31805 EMAGE:31805 EMAGE:31805
euxassay_019492_11 euxassay_019492_12 euxassay_019492_13 euxassay_019492_14 euxassay_019492_15
EMAGE:31805 EMAGE:31805 EMAGE:31805 EMAGE:31805 EMAGE:31805
euxassay_019492_16 euxassay_019492_17 euxassay_019492_18 euxassay_019492_19 euxassay_019492_20
EMAGE:31805 EMAGE:31805 EMAGE:31805 EMAGE:31805
euxassay_019492_21 euxassay_019492_22 euxassay_019492_23 euxassay_019492_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 21 22 weak expression: see section 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 21 22 weak expression: see section 23
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 21 22 weak expression: see section 23 24
cervical ganglion
moderate moderate
regionalmoderate expression: see section 12 20
adrenal medulla
moderate moderate
regionalmoderate expression: see section 13 19 21 22 weak expression: see section 11 12 20
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 11 21 moderate expression: see section 09 10 22
trigeminal v nerve
strong strong
regionalstrong expression: see section 10 17
thoracic ganglion
strong strong
regionalstrong expression: see section 15 17
midgut
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55204
Entity Detected:Tlx2, T-cell leukemia, homeobox 2 ( MGI:1350935)
Sequence:sense strand is shown

>T55204
CGCCAACGTGGCCGGGTGCCGTACCGCCAGCGAAGAGTGAGGAGCAGAAGGCCCGCGGCCCGCGGCCGTC
CTCTGAGGCTCTTTGGTCATCAGTGGCCCCTGGCCCACACTCTGACTCCGCCCTTCAAGGTTTTGTTTTG
TTTTGTTTAAAAAAAAAAACCCCGCTGAGATGTGGGTTGCAAGAGCAACCTGCAGGATTGTGGATGAAGC
AGGGACCCTGCAAGGCTGCGACTTTGCCCTGAGTGGGCTCAGAGCTCAGGTCCTGCTGGGAAGGGACCAC
AGAGCTGGTGTAAAGGCAGATATCAAAGGACAGCGGGGGAGGGGTAATGGAAGAGGCGCTGGCAGTAGAG
AATGTGGCCTACTGTGACAGGGACCTCGTCCCTCATCTGTAAAACAATAACTAAGGATTCCTTC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. .
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_019492 same experiment
 EMAGE:13671 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS