Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31815

Nedd4l ( MGI:1933754)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31815 EMAGE:31815 EMAGE:31815 EMAGE:31815 EMAGE:31815
euxassay_011535_01 euxassay_011535_02 euxassay_011535_03 euxassay_011535_04 euxassay_011535_05
EMAGE:31815 EMAGE:31815 EMAGE:31815 EMAGE:31815 EMAGE:31815
euxassay_011535_06 euxassay_011535_07 euxassay_011535_08 euxassay_011535_09 euxassay_011535_10
EMAGE:31815 EMAGE:31815 EMAGE:31815 EMAGE:31815 EMAGE:31815
euxassay_011535_11 euxassay_011535_12 euxassay_011535_13 euxassay_011535_14 euxassay_011535_15
EMAGE:31815 EMAGE:31815 EMAGE:31815 EMAGE:31815 EMAGE:31815
euxassay_011535_16 euxassay_011535_17 euxassay_011535_18 euxassay_011535_19 euxassay_011535_20
EMAGE:31815 EMAGE:31815 EMAGE:31815
euxassay_011535_21 euxassay_011535_22 euxassay_011535_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vestibulocochlear viii ganglion
strong strong
homogeneousstrong expression: see section 06
metanephros
strong strong
regionalstrong expression: see section 09 10 17 18 19 moderate expression: see section 07 08
spinal cord
strong strong
regionalstrong expression: see section 09 10 11 13 14 15 16 moderate expression: see section 12
rectum
strong strong
regionalstrong expression: see section 14
esophagus
strong strong
regionalstrong expression: see section 13
pancreas
moderate moderate
regionalmoderate expression: see section 09 10 11 14 15 17
facial vii ganglion
strong strong
homogeneousstrong expression: see section 06
vagus x ganglion
strong strong
homogeneousstrong expression: see section 07 08 17
leg muscle
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 19 20 21 22 23
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 16 17 18 19 20 21 22 23 weak expression: see section 09 10 11 15
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 17 18 19 20 21
arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 04 05 20 21 22
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 13 14 15 16 17
hand
moderate moderate
regionalmoderate expression: see section 03 04
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 21 22 23
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23 moderate expression: see section 12
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 06 07 17 18
tongue muscle
strong strong
regionalstrong expression: see section 14 15 moderate expression: see section 11 12 13
midgut
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 20
urinary system
strong strong
spottedstrong expression: see section 05 20 21 22
forearm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 16 17
foot
moderate moderate
regionalmoderate expression: see section 04 05 06 07 20 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30347
Entity Detected:Nedd4l, ( MGI:1933754)
Sequence:sense strand is shown

>T30347
TGCAGCTTGCAGAAGACGGTGCCTCCGGATCAGCCACAAACAGTAACAACCACCTAGTCGAACCCCAGAT
CCGCCGGCCCCGTAGCCTCAGCTCGCCAACAGTAACTTTATCTGCCCCACTGGAGGGTGCCAAGGATTCA
CCCATCCGCCGTGCCGTGAAAGATACCCTTTCCAATCCACAGTCCCCTCAGCCATCACCTTACAACTCCC
CCAAACCACAACACAAAGTCACACAGAGCTTCCTGCCACCAGGCTGGGAGATGAGGATAGCCCCCAACGG
CCGACCCTTCTTCATTGACCATAACACAAAGACTACAACCTGGGAAGATCCACGGTTGAAATTTCCAGTA
CACATGCGGTCAAAAGCATCTTTAAACCCCAATGACCTGGGCCCTCTTCCTCCTGGCTGGGAAGAGAGGA
TCCACTTGGATGGCCGCACGTTTTACATTGACCATAATAGTAAAATTACCCAGTGGGAAGATCCAAGACT
ACAGAACCCAGCCATCACTGGTCCGGCTGTTCCGTACTCCAGAGAGTTTAAGCAGAAATACGACTACTTT
AGGAAGAAATTAAAGAAGCCTGCTGATATTCCAAACAGGTTTGAAATGAAACTTCACAGAAACAACATAT
TTGAAGAGTCCTATCGGAGGATCATGTCTGTAAAGAGACCTGACGTCCTAAAGGCTAGGCTGTGGATTGA
GTTTGAATCAGAGAAAGGCCTGGACTATGGGGGCGTGGCCAGAGAATGGTTCTTCTTACTGTCCAAAGAG
ATGTTTAACCCCTACTATGGCCTCTTCGAGTACTCTGCCACGGACAACTACACACTTCAGATCAATCCCA
ACTCAGGCCTCTGTAATGAAGACCATTTGTCCTATTTCACCTTCATTGGAAGAGTTGCTGGCCTAGCGGT
GTTTCATGGGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3157137), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 33724. Forward Primer - name:033724_F_IRAV81-84_L20_Nedd4l, sequence:TGCAGCTTGCAGAAGACG; Reverse Primer - name:033724_R_SP6_IRAV81-84_L20_Nedd4l, sequence:TTCCCATGAAACACCGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011535 same experiment
 EMAGE:31812 same embryo
 EMAGE:31894 same embryo
 EMAGE:31775 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS