Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31822

Ufsp1 UFM1-specific peptidase 1 ( MGI:1917490)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31822 EMAGE:31822 EMAGE:31822 EMAGE:31822 EMAGE:31822
euxassay_013716_01 euxassay_013716_02 euxassay_013716_03 euxassay_013716_04 euxassay_013716_05
EMAGE:31822 EMAGE:31822 EMAGE:31822 EMAGE:31822 EMAGE:31822
euxassay_013716_06 euxassay_013716_07 euxassay_013716_08 euxassay_013716_09 euxassay_013716_10
EMAGE:31822 EMAGE:31822 EMAGE:31822 EMAGE:31822 EMAGE:31822
euxassay_013716_11 euxassay_013716_12 euxassay_013716_13 euxassay_013716_14 euxassay_013716_15
EMAGE:31822 EMAGE:31822 EMAGE:31822 EMAGE:31822 EMAGE:31822
euxassay_013716_16 euxassay_013716_17 euxassay_013716_18 euxassay_013716_19 euxassay_013716_20
EMAGE:31822 EMAGE:31822 EMAGE:31822
euxassay_013716_21 euxassay_013716_22 euxassay_013716_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18 19
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 16
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 10 11 18
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 14
diaphragm
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 19 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 19 20 21 22
eye skeletal muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 17 18
leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 17 18 19 20 21 22 23
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
thymus primordium
strong strong
regionalstrong expression: see section 10 11 12 13 14
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 18 19 20 21 22
arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 22 23
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 21 22
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 09 17
hand
strong strong
regionalstrong expression: see section 02 03 04 05
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 14 15
ventral grey horn
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15
tegmentum
moderate moderate
regionalmoderate expression: see section 11
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16
pons mantle layer
strong strong
regionalstrong expression: see section 06 15 16
tongue muscle
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 12 14 15 16 17
foot
strong strong
regionalstrong expression: see section 06 21 22 23
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 07 08 09 15 16
liver
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32003
Entity Detected:Ufsp1, UFM1-specific peptidase 1 ( MGI:1917490)
Sequence:sense strand is shown

>T32003
ACACCAGGAACCCGGAATTGGCCCTGCCTCGATGACAGCTGCTCTACCGAGCACCCTGGAGCTGCTGAAG
GACGTGCACCTGGGCCTGCCTGTGCCCTGCCATGATCCCGCCCGACTGGCCCTCCTCTCAGGCCACTACC
TTTACTATCACTATGGTTGCGATGGACTGGATGACCGTGGCTGGGGATGCGGCTACCGCACCCTGCAGAC
GCTGTGCTCCTGGCCAGGGGGCCAGTCCTCAGGCGTGCCTGGACTGCCAGCCTTGCAGGGAGCCCTAGAG
GCCATGGGCGACAAGCCCCCCGGATTCCGGGGCTCCCGTAACTGGATCGGCTGTGTAGAGGCCAGTCTCT
GCCTAGAACACTTCGGAGGACCTCAAGGGCGCCTATGCCACTTACCCCGCGGAGTAGGGCTTAGGGGAGA
AGAGGAGCGGCTTTATTCACACTTTACAACGGGTGGGGGCCCAGTAATGGTAGGAGGAGATGCAGATGCC
CAGTCCAAGGCCCTGCTGGGGATCTGTGAGGGGCCAGGTTCAGAAGTCTATGTCTTGATACTGGACCCAC
ACTACTGGGGCACTCCAAAAAACCGTTGTGAACTACAAGCTGCTGGATGGGTGGGCTGGCAAAAGGTAAA
AAGCGTCTTTGATTCCAATTCCTTCTACAACTTGTGCTTCACCAGAAATCTCTGAATCACCACGCCCTAC
CTGCACCGTTGGGTAGATCCCAGAACTGAGACTAAACACAGCCACCTATTTACTTCGCACAGGCCCCCAC
CGCGATCAAGTTTGGGCCTGGCACAATGATACGGGCAGGTGAATCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3584484), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 21465. Forward Primer - name:021465_F_IRAV32-35_G17_2700038N03Rik, sequence:ACACCAGGAACCCGGAAT; Reverse Primer - name:021465_R_SP6_IRAV32-35_G17_2700038N03Rik, sequence:TCAGATTCACCTGCCCG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_013716 same experiment
 EMAGE:29737 same embryo
 EMAGE:31706 same embryo
 EMAGE:31783 same embryo
 EMAGE:29655 same embryo
 EMAGE:31732 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS