Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31838

Sec16b SEC16 homolog B (S. cerevisiae) ( MGI:2148802)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31838 EMAGE:31838 EMAGE:31838 EMAGE:31838 EMAGE:31838
euxassay_002806_01 euxassay_002806_02 euxassay_002806_03 euxassay_002806_04 euxassay_002806_05
EMAGE:31838 EMAGE:31838 EMAGE:31838 EMAGE:31838 EMAGE:31838
euxassay_002806_06 euxassay_002806_07 euxassay_002806_08 euxassay_002806_09 euxassay_002806_10
EMAGE:31838 EMAGE:31838 EMAGE:31838 EMAGE:31838 EMAGE:31838
euxassay_002806_11 euxassay_002806_12 euxassay_002806_13 euxassay_002806_14 euxassay_002806_15
EMAGE:31838 EMAGE:31838 EMAGE:31838 EMAGE:31838 EMAGE:31838
euxassay_002806_16 euxassay_002806_17 euxassay_002806_18 euxassay_002806_19 euxassay_002806_20
EMAGE:31838 EMAGE:31838 EMAGE:31838 EMAGE:31838
euxassay_002806_21 euxassay_002806_22 euxassay_002806_23 euxassay_002806_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
meckel's cartilage
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 19 20 moderate expression: see section 18 21 22 23 24
lower jaw molar
strong strong
regionalstrong expression: see section 06 07 08 09 10 19 20 moderate expression: see section 18 21
upper jaw molar
strong strong
regionalstrong expression: see section 06 07 08 09 10 19 20 moderate expression: see section 18 21
femur
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 18 19 20 21 22 23
pectoral girdle and thoracic body wall musculature
strong strong
regionalstrong expression: see section 07 08 09 10 moderate expression: see section 11 12 13 14 15 16 17 18 19 20 21 22 23 24
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 13 14 moderate expression: see section 15 16 17
upper jaw incisor
strong strong
regionalstrong expression: see section 11 12 moderate expression: see section 15 16 17
rib
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 moderate expression: see section 21 22 23 24
axial skeleton
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
orbito-sphenoid
strong strong
regionalstrong expression: see section 24 moderate expression: see section 02 03 04 05 06 07 08 09 19 20 21 22 23
viscerocranium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 17 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T432
Entity Detected:Sec16b, SEC16 homolog B (S. cerevisiae) ( MGI:2148802)
Sequence:sense strand is shown

>T432
GTTTCGTACGTAGCAGAGCAGCTCCCTCGCTGCGATCTATTGAAAGTCAGCCCTCGACACAAGGGTTTGT
CTACGCCCTACCCTGATCTCTCTGGCCATCAAAACTACTCAGAAGACTCTGAGTACAGCTCCACCTTGTG
GTCAACAGCAGAGCAGACAAGCCTGACCAATCCCCTCGCACAGCAGTCTTTCCCCCTGCAGCGAGATACC
TATTCAGGACACATGGGAACCCCAGTGCCTCTCTACTCAGTTCCTGCAACCCACTTGGCAGTGACGAGTG
GAGCCAGTGGTAGCAGTGTGGCAGTGACGGGGACTCCTGGGGGAAGGGTTGGAGAGGATATGCTGCGGAC
ACATCCTGCCTTTGGAGAGAACACAATGACTCAAGAACCCCTGGAAGATCCTGATGGTCTCGAAGTCATT
TCCAGTCTTCAGACACCAGCAGCTCCCAGGGTTCCAAGTTTTTCTGAGGATTCTGCTGCTT
Notes:The probe template was PCR amplified from IMAGE:3164645 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3164645 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002806 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS