Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31842

Il16 interleukin 16 ( MGI:1270855)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31842 EMAGE:31842 EMAGE:31842 EMAGE:31842 EMAGE:31842
euxassay_002804_01 euxassay_002804_02 euxassay_002804_03 euxassay_002804_04 euxassay_002804_05
EMAGE:31842 EMAGE:31842 EMAGE:31842 EMAGE:31842 EMAGE:31842
euxassay_002804_06 euxassay_002804_07 euxassay_002804_08 euxassay_002804_09 euxassay_002804_10
EMAGE:31842 EMAGE:31842 EMAGE:31842 EMAGE:31842 EMAGE:31842
euxassay_002804_11 euxassay_002804_12 euxassay_002804_13 euxassay_002804_14 euxassay_002804_15
EMAGE:31842 EMAGE:31842 EMAGE:31842 EMAGE:31842 EMAGE:31842
euxassay_002804_16 euxassay_002804_17 euxassay_002804_18 euxassay_002804_19 euxassay_002804_20
EMAGE:31842 EMAGE:31842 EMAGE:31842
euxassay_002804_21 euxassay_002804_22 euxassay_002804_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
trachea
strong strong
regionalstrong expression: see section 13 14 15
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 21 22
thymus primordium
strong strong
regionalstrong expression: see section 11 13 14 15 moderate expression: see section 12 16
vibrissa
strong strong
regionalstrong expression: see section 03 04 05 20 21 22
pectoral girdle and thoracic body wall musculature
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 17 18 20 21 22 weak expression: see section 04 05 19
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 21
axial skeleton
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 16
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3601
Entity Detected:Il16, interleukin 16 ( MGI:1270855)
Sequence:sense strand is shown

>T3601
GAGACAGACAGAGGTAGAGTCTATGTCCACAACCTTCCCTAACTCCTCAGAGGTCAGGGACCCAGGTTTG
CCTGAGTCTCCTCCCCCAGGTCAGCGACCCAGCACAAAAGCTTTGTCTCCAGACCCTCTCTTGAGACTGT
TGACTACACAATCCGAGGATACTCAAGGACCAGGTCTCAAGATGCCAAGTCAGCGGGCACGGAGCTTCCC
CCTGACCAGGACCCAGTCCTGCGAGACAAAGCTGTTGGATGAAAAGGCCAGTAAGCTTTACTCCATCAGC
AGCCAGCTATCATCTGCTGTCATGAAATCCCTGCTGTGCCTTCCATCTTCAGTCTCTTGTGGCCAGATCA
CCTGCATCCCCAAGGAGAGGGTGTCTCCAAAGTCACCTTGCAACAACAGCTCAGCTGCAGAGGGTTTTGG
TGAAGCCATGGCCTCTGACACAGGGTTCTCTCTCAACCTTTCAGAGCTGAGAGAATATTCAGAAGGTCTC
ACAGAGCCCGGGGAAACCGAGGACAGGAACCACTGTTCTTCTCAGGCC
Notes:The probe template was PCR amplified from IMAGE:3167627 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3167627 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002804 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS