Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31845

Tubb6 tubulin, beta 6 class V ( MGI:1915201)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31845 EMAGE:31845 EMAGE:31845 EMAGE:31845 EMAGE:31845
euxassay_002809_01 euxassay_002809_02 euxassay_002809_03 euxassay_002809_04 euxassay_002809_05
EMAGE:31845 EMAGE:31845 EMAGE:31845 EMAGE:31845 EMAGE:31845
euxassay_002809_06 euxassay_002809_07 euxassay_002809_08 euxassay_002809_09 euxassay_002809_10
EMAGE:31845 EMAGE:31845 EMAGE:31845 EMAGE:31845 EMAGE:31845
euxassay_002809_11 euxassay_002809_12 euxassay_002809_13 euxassay_002809_14 euxassay_002809_15
EMAGE:31845 EMAGE:31845 EMAGE:31845 EMAGE:31845 EMAGE:31845
euxassay_002809_16 euxassay_002809_17 euxassay_002809_18 euxassay_002809_19 euxassay_002809_20
EMAGE:31845 EMAGE:31845 EMAGE:31845 EMAGE:31845
euxassay_002809_21 euxassay_002809_22 euxassay_002809_23 euxassay_002809_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
strong strong
regionalstrong expression: see section 01 02 03 moderate expression: see section 24
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 08 17 18 19
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11 16
tongue
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 18
thoracic ganglion
strong strong
regionalstrong expression: see section 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 16 17 18 19
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 20 21 22
not examined not examined
regionalnot examined expression: see section 01 02 03 24
vagus x ganglion
strong strong
regionalstrong expression: see section 08 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22 23
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 15 16 17 18 19 20
nucleus pulposus
moderate moderate
regionalmoderate expression: see section 13 14 15 16
cervical ganglion
moderate moderate
regionalmoderate expression: see section 11 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2239
Entity Detected:Tubb6, tubulin, beta 6 class V ( MGI:1915201)
Sequence:sense strand is shown

>T2239
TGGCCTCGAGCCAGAATTCGGATCCTTGCGGCCATGTTCCGCCGCAAGGCCTTCCTGCACTGGTTCACCG
GCGAGGGCATGGACGAGATGGAGTTCACCGAGGCCGAGAGTAACATGAATGACCTGGTGTCCGAGTACCA
GCAGTACCAGGACGCCACGGTCAATGATGGGGAAGAGGCATTTGAAGACGAGGATGAAGAAGAGATCAAC
GAATAGGGAGCCATAAGATGCTACAGTGTACGTCTGCTCTTTTCTTTAGCCTTGATGGTGTGGGAATGGT
GCCCTGGTCTAAGCATGTCACTGGCCCCTCTCAAACCAAATGCACCACACTGTTCTCCAGGTTACCTGGA
ACAGTCCCAGCAGACCAGGGAGATCTCATATAGGAACCCTGAAAGCAAAGTAGGGGGCTCACACAGGGCT
AAAGAAAGTGACCACCTTTTGTTAAGCCCCCTTCCCACCCCATCAGAGTTAGAATAGGGATTTGTTTTTC
ATCCTCGGTGATAAAAACTAAAGCCACACAGTGCTGCCTTAAGTGAATGCACACT
Notes:The probe template was PCR amplified from IMAGE:1050784 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1050784 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002809 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS