Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31846

Tspan17 tetraspanin 17 ( MGI:1921507)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31846 EMAGE:31846 EMAGE:31846 EMAGE:31846 EMAGE:31846
euxassay_002808_01 euxassay_002808_02 euxassay_002808_03 euxassay_002808_04 euxassay_002808_05
EMAGE:31846 EMAGE:31846 EMAGE:31846 EMAGE:31846 EMAGE:31846
euxassay_002808_06 euxassay_002808_07 euxassay_002808_08 euxassay_002808_09 euxassay_002808_10
EMAGE:31846 EMAGE:31846 EMAGE:31846 EMAGE:31846 EMAGE:31846
euxassay_002808_11 euxassay_002808_12 euxassay_002808_13 euxassay_002808_14 euxassay_002808_15
EMAGE:31846 EMAGE:31846 EMAGE:31846 EMAGE:31846 EMAGE:31846
euxassay_002808_16 euxassay_002808_17 euxassay_002808_18 euxassay_002808_19 euxassay_002808_20
EMAGE:31846 EMAGE:31846 EMAGE:31846 EMAGE:31846
euxassay_002808_21 euxassay_002808_22 euxassay_002808_23 euxassay_002808_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04
metencephalon basal plate
strong strong
regionalstrong expression: see section 07 18
ventral grey horn
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10 16 17
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 19
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 16 17 18 moderate expression: see section 12
facial vii ganglion
strong strong
regionalstrong expression: see section 06 07 moderate expression: see section 21 22
not examined not examined
regionalnot examined expression: see section 02 03 04
medulla oblongata basal plate
strong strong
regionalstrong expression: see section 08 09 10 15 16 17
vagus x ganglion
strong strong
regionalstrong expression: see section 08 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 18 19 20 moderate expression: see section 03 04 05 21 22 23
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2252
Entity Detected:Tspan17, tetraspanin 17 ( MGI:1921507)
Sequence:sense strand is shown

>T2252
TGGCCTCGAGCCAGATTCGGATCCTTGGTGAGAAGGGCGTTCTCTCCAACATCTCGGCGCTGACAGATCT
GGGCGGTCTTGACCCCGTGTGGCTGTTTGTGGTGGTGGGGGGAGTCATGTCAGTGTTGGGCTTCGCCGGC
TGCATTGGGGCCCTCCGGGAAAACACCTTCCTGCTCAAGTTCTTCTCTGTGTTCCTCGGCCTCATCTTCT
TCCTGGAGCTGGCCGCGGGGATCCTGGCCTTCGTCTTCAAGGATTGGATCCGAGACCAACTTAATCTCTT
CATCAACAACAATGTCAAAGCCTACCGGGATGATCTCGACCTTCAGAACCTTATCGACTTTGCTCAGGAA
TACTGGTCTTGCTGTGGTGCCCGAGGGCCCAATGACTGGAACCTCAATATCTACTTCAACTGCACTGACT
TGAACCCAAGCCGTGAGCGCTGTGGGGTGCCCTTTTCCTGCTGTGTTAGGGACCCAGCGGAAGATGTCCT
CAATACCCAGTGTGGCTATGACATCCGACTCAAACTGG
Notes:The probe template was PCR amplified from IMAGE:1064383 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1064383 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002808 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS