Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31848

E330013P04Rik ( MGI:2147732)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31848 EMAGE:31848 EMAGE:31848 EMAGE:31848 EMAGE:31848
euxassay_011761_01 euxassay_011761_02 euxassay_011761_03 euxassay_011761_04 euxassay_011761_05
EMAGE:31848 EMAGE:31848 EMAGE:31848 EMAGE:31848 EMAGE:31848
euxassay_011761_06 euxassay_011761_07 euxassay_011761_08 euxassay_011761_09 euxassay_011761_10
EMAGE:31848 EMAGE:31848 EMAGE:31848 EMAGE:31848 EMAGE:31848
euxassay_011761_11 euxassay_011761_12 euxassay_011761_13 euxassay_011761_14 euxassay_011761_15
EMAGE:31848 EMAGE:31848 EMAGE:31848 EMAGE:31848 EMAGE:31848
euxassay_011761_16 euxassay_011761_17 euxassay_011761_18 euxassay_011761_19 euxassay_011761_20
EMAGE:31848 EMAGE:31848 EMAGE:31848 EMAGE:31848
euxassay_011761_21 euxassay_011761_22 euxassay_011761_23 euxassay_011761_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
radius
weak weak
regionalweak expression: see section 01
forelimb digit 2 phalanx
weak weak
regionalweak expression: see section 05 06
humerus
weak weak
regionalweak expression: see section 01 02 03 20 21 22 23 24
forelimb digit 3 phalanx
weak weak
regionalweak expression: see section 05 06
hindlimb digit 4 mesenchyme
weak weak
regionalweak expression: see section 08 09
pelvic girdle skeleton
weak weak
regionalweak expression: see section 10 17 18
axial skeleton
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16
nose
weak weak
homogeneousweak expression: see section 09 10 11 12 13 14 15 17 18 19 20 21 22
otic capsule
weak weak
homogeneousweak expression: see section 05 06 07 08 15 16
hindlimb digit 3 mesenchyme
weak weak
regionalweak expression: see section 08 09 24
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 16 17 18 19 20 21
tibia
weak weak
regionalweak expression: see section 01 02 03 04
femur
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 20 21 22 23 24
naris
weak weak
homogeneousweak expression: see section 15 16 17 18
nasal septum
weak weak
homogeneousweak expression: see section 15 16
orbito-sphenoid
weak weak
homogeneousweak expression: see section 01 02 03 04 05 07 08 09 20 21 22 23
temporal bone petrous part
weak weak
homogeneousweak expression: see section 01 02 03 04 18 19 20 21 22 23
vault of skull
weak weak
homogeneousweak expression: see section 01
fibula
weak weak
regionalweak expression: see section 01 02 03 04
rib
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24
hindlimb digit 2 mesenchyme
weak weak
regionalweak expression: see section 08 09 24
meckel's cartilage
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22
basioccipital bone
weak weak
homogeneousweak expression: see section 01 02 03 04 05 07 10 11 12 13 14 15 16 17 18 22 23 24
basisphenoid bone
weak weak
homogeneousweak expression: see section 08 09 10 11 12 13 14
hand mesenchyme
weak weak
regionalweak expression: see section 02
scapula
weak weak
regionalweak expression: see section 01 02 03 20 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37693
Entity Detected:E330013P04Rik, ( MGI:2147732)
Sequence:sense strand is shown

>T37693
TTACATGGTACGAAACAGCGACTCCTCTTGGTGACCTGAACAGTTAACAAGATACTAACTGCACTCGGCC
AAAAATGAGTGCGACTTTCATTTCCTCCTTTCATCCAGGCGCTCTACAAGCATTCTTATACAGTTGTATA
CGCTCATGCTCTGCCCTCCAGCCGCTCAAACGATGAAGGTTATCAAGGTGAAAAACATCTATTGAGATGG
ATGGAGAGGAGAGTGGGGCCCACCAGGAAGTGAGGTCGCAACTGACCAAACAAGCACGGTAAAATATTCA
CAAAGATAAATTAAAAAAAAAATCACAAAGCATGGGGAAAGAGAACCGAAGGTTGAAAAATGGCAAATGT
AAAAAGACCCCACGGCACACAATAACATCACACATTCTGGGACCTGGAAATTAAGTGGAATATCCCAGCA
GTCCACAGCTGTCCACCCTGACAAGATAATAAAGGGGAGGGAGGCTAGAGATAACACAGAGACTTATCTC
CATTCATATGTCCTGGAAATATCGTGGACCCTGCATTTTTGAGGCCTCCAAACTCTTTGATCACCTATCC
GCACACACCCCTCACAAAGGTTTGATCATCACCTTCCTATCTAGCTATTATGTGTTCCTCTGTTTCAAGC
TATGTAGTGCTACCCAGTATTACTTGCTGTGCTCCCCAAATGTTGGTTCTAATATTTCTCCCATGCCAAC
GGAATGTTGACCATGTCAAATGCCACCAAGTTGATGGGGTCCAAGGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 101024. Forward Primer - name:101024_F_cDNA_E330013P04Rik, sequence:TTACATGGTACGAAACAGCGAC; Reverse Primer - name:101024_N_SP6_cDNA_E330013P04Rik, sequence:GTCCTTGGACCCCATCAACT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011761 same experiment
 EMAGE:30590 same embryo
 EMAGE:30596 same embryo
 EMAGE:30587 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS