Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31856

Klhl14 ( MGI:1921249)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31856 EMAGE:31856 EMAGE:31856 EMAGE:31856 EMAGE:31856
euxassay_008587_01 euxassay_008587_02 euxassay_008587_03 euxassay_008587_04 euxassay_008587_05
EMAGE:31856 EMAGE:31856 EMAGE:31856 EMAGE:31856 EMAGE:31856
euxassay_008587_06 euxassay_008587_07 euxassay_008587_08 euxassay_008587_09 euxassay_008587_10
EMAGE:31856 EMAGE:31856 EMAGE:31856 EMAGE:31856 EMAGE:31856
euxassay_008587_11 euxassay_008587_12 euxassay_008587_13 euxassay_008587_14 euxassay_008587_15
EMAGE:31856 EMAGE:31856 EMAGE:31856 EMAGE:31856 EMAGE:31856
euxassay_008587_16 euxassay_008587_17 euxassay_008587_18 euxassay_008587_19 euxassay_008587_20
EMAGE:31856 EMAGE:31856 EMAGE:31856
euxassay_008587_21 euxassay_008587_22 euxassay_008587_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
ventral grey horn
strong strong
single cellstrong expression: see section 09 10 11 12 13 14 moderate expression: see section 15
kidney calyx
moderate moderate
regionalmoderate expression: see section 08 09 weak expression: see section 06 07 10 16 17 18 19 20
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 17 18
cochlea
moderate moderate
regionalmoderate expression: see section 06 07 08 17 18 20 weak expression: see section 19
thyroid gland
moderate moderate
regionalmoderate expression: see section 10 11 12 15
dorsal grey horn
strong strong
single cellstrong expression: see section 09 10 11 12 13 14 moderate expression: see section 15
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 13 14 15 16 17
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14 15
kidney pelvis
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 18
adrenal gland
weak weak
regionalweak expression: see section 07 08 09 16 17 18
vibrissa
weak weak
regionalweak expression: see section 08 09 22 23
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 10 11 12 16 17 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 07 08 09 13 14 15 16 17
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 07 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35737
Entity Detected:Klhl14, ( MGI:1921249)
Sequence:sense strand is shown

>T35737
GAGGATACAGCTGGAGTATGGGTGCCTACAAGTCATCTACAATCTGCTATTGTCCAGAAAAAGGAACCTG
GACAGAACTCGAAGGTGATGTGGCTGAACCCCTGGCAGGCCCAGCCTGTGCAACAGTCATTCTACCAGCC
TGTGTACCCTACAACAAATGACAGCAGGAAACCACGGCATAGTGCCACCATCCAGGGTGCAGGGACAGAT
GATGTGCTGTCCTGTATGAACCATGCATTCCAATGGTACAACTGCCCAAATCCACCTTTGGTTTCTGATG
ACTTACAAGTGACTATAGAAGAAAGAGGCCTGGTCTTGAGCAGAGACTCTTGTTCGCAACTCAGATCACA
CTCCAATTGTGGTGACAGACTCTTCCATATCAGGCTGGTTTTGCTTTGTTCCGCCTTTACACAAACTCAA
GTGGAGCTGAACTTTCACAAAGGGAAAGATAAACCACAGAAGCCTGGCCCCAGAGACCTAAGACCTGTAT
TGTGCATTGTTTCCTAACTGCATGTGATAGACTTGGACATTTGGAGAATATTTTGTACATGAATGATTCA
AAATCCAACCCACCAAATGGTTACCCTGTATTCCAGAAACTCACTTGATTCTGTATTGGTAAATGCCTGG
CTTCTTCACCAACTCCATAGGTAACACAGCAAAGGAAAACCACAGAAGACAGAAGACAGGCATCTTTGTT
TCCACACAATCATATTTTCTATTCCTAACAGCTTCCCGTGGGAAAAGTAAGCTGTTGATCTCTTTGGCAA
TTGTTCTCTGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 85706. Forward Primer - name:085706_F_cDNA_6330403N15Rik, sequence:GAGGATACAGCTGGAGTATGGG; Reverse Primer - name:085706_N_SP6_cDNA_6330403N15Rik, sequence:GGCAGAGAACAATTGCCAAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008587 same experiment
 EMAGE:31317 same embryo
 EMAGE:31891 same embryo
 EMAGE:29471 same embryo
 EMAGE:31893 same embryo
 EMAGE:30623 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS