Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31871

Bcl11a B-cell CLL/lymphoma 11A (zinc finger protein) ( MGI:106190)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31871 EMAGE:31871 EMAGE:31871 EMAGE:31871 EMAGE:31871
euxassay_002814_01 euxassay_002814_02 euxassay_002814_03 euxassay_002814_04 euxassay_002814_05
EMAGE:31871 EMAGE:31871 EMAGE:31871 EMAGE:31871 EMAGE:31871
euxassay_002814_06 euxassay_002814_07 euxassay_002814_08 euxassay_002814_09 euxassay_002814_10
EMAGE:31871 EMAGE:31871 EMAGE:31871 EMAGE:31871 EMAGE:31871
euxassay_002814_11 euxassay_002814_12 euxassay_002814_13 euxassay_002814_14 euxassay_002814_15
EMAGE:31871 EMAGE:31871 EMAGE:31871 EMAGE:31871 EMAGE:31871
euxassay_002814_16 euxassay_002814_17 euxassay_002814_18 euxassay_002814_19 euxassay_002814_20
EMAGE:31871 EMAGE:31871 EMAGE:31871 EMAGE:31871
euxassay_002814_21 euxassay_002814_22 euxassay_002814_23 euxassay_002814_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 09 10 11 12 19 20 21 22
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 08 10 23 24
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 10 11 12 13 14 18 19 20 21
naris
strong strong
regionalstrong expression: see section 14 15 16 18 19 20
lower jaw incisor
strong strong
regionalstrong expression: see section 14 15 18 19
upper jaw incisor
strong strong
regionalstrong expression: see section 14 15 18 19
dorsal grey horn
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 moderate expression: see section 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3860
Entity Detected:Bcl11a, B-cell CLL/lymphoma 11A (zinc finger protein) ( MGI:106190)
Sequence:sense strand is shown

>T3860
TGGCCTCGAGNCAGATTCGGACGAGGGCCATTTTTTTCTCTCTCTCTCTCCCTCTATCCCTCTTCTCTCT
TCCTCTCTCTCTTTTTTTTCCTTAAAAAAAAAAAAGCCATGACGGCTCTCCCACAATTCATCTTCCCTGC
GCCATCTTTGTATTATTTCTAATTTATTTTGGATGTCAAAAGGCACTGATGAAGATATTTTCTCTGGAGT
CTCCTTCTTTCTAACCCGGCTCTCCCGATGTGAACCGAGCCGTCGTCCGCACGCCGCCGCCGCCGCCGCC
GCCCGCCCCGCAGCCCACCATGTCTCGCCGCAAGCAAGGCAAACCCCAGCACTTAAGCAAACGGGAATTC
TCGCCCGAACCTCTTGAAGCCATTCTTACAGATGATGAACCAGACCATGGCCCGTTGGGAGCTCCAGAAG
GGGACCACGACCTTCTCACCTGTGGGCAGTGCCAGATGAATTTCCCACTGGGGGACATTCTTATTTTTAT
CGAGCACAAACGGAAACAATGCAATGGCAGCCTCTGCTTAGAAAAAGGTGTGGATAAGC
Notes:The probe template was PCR amplified from IMAGE:425021 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:425021 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002814 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS