Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31873

Atp6v1c2 ATPase, H+ transporting, lysosomal V1 subunit C2 ( MGI:1916025)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31873 EMAGE:31873 EMAGE:31873 EMAGE:31873 EMAGE:31873
euxassay_002813_01 euxassay_002813_02 euxassay_002813_03 euxassay_002813_04 euxassay_002813_05
EMAGE:31873 EMAGE:31873 EMAGE:31873 EMAGE:31873 EMAGE:31873
euxassay_002813_06 euxassay_002813_07 euxassay_002813_08 euxassay_002813_09 euxassay_002813_10
EMAGE:31873 EMAGE:31873 EMAGE:31873 EMAGE:31873 EMAGE:31873
euxassay_002813_11 euxassay_002813_12 euxassay_002813_13 euxassay_002813_14 euxassay_002813_15
EMAGE:31873 EMAGE:31873 EMAGE:31873 EMAGE:31873 EMAGE:31873
euxassay_002813_16 euxassay_002813_17 euxassay_002813_18 euxassay_002813_19 euxassay_002813_20
EMAGE:31873 EMAGE:31873 EMAGE:31873
euxassay_002813_21 euxassay_002813_22 euxassay_002813_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 16 17 18 19 moderate expression: see section 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T163
Entity Detected:Atp6v1c2, ATPase, H+ transporting, lysosomal V1 subunit C2 ( MGI:1916025)
Sequence:sense strand is shown

>T163
CCAAATTGATCGCCGAGGACAACGAAGGTGGCCTCTTCACGGTGACTCTCTTCCGAAAAGTGATCGAAGA
TTTCAAAGTCAAAGCCAAAGAAAACAAGTTCATTGTCCGGGAATTTTACTATGATGAAAAAGAAATTAAA
CGAGAAAGGGAGGAGATGACCAGGTTGCTGTCTGATAAGAAACAACAGTATCCAACTTCCTGTGTTGCTC
TAAAAAAGGGATCAGCCACCTACCGTGACCACAAGGTTAAGGTAGCCCCGCTAGGTAACCCTGCTAGGCC
TGCTGCGGGGCAGACCGACAGAGACAGAGAGAGTGAGGGCGAGGGTGAGGGACCTCTGCTGCGCTGGCTC
AAGGTGAACTTCAGCGAGGCCTTTATTGCCTGGATCCACATTAAGGCCCTGAGAGTGTTTGTGGAGTCTG
TGCTCAGGTATGGACTTCCAGTGAACTTCCAGGCTGTGCTCCTACAGCCCCACAA
Notes:The probe template was PCR amplified from IMAGE:2645167 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2645167 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002813 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS