Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31876

Ap3m2 adaptor-related protein complex 3, mu 2 subunit ( MGI:1929214)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31876 EMAGE:31876 EMAGE:31876 EMAGE:31876 EMAGE:31876
euxassay_002812_01 euxassay_002812_02 euxassay_002812_03 euxassay_002812_04 euxassay_002812_05
EMAGE:31876 EMAGE:31876 EMAGE:31876 EMAGE:31876 EMAGE:31876
euxassay_002812_06 euxassay_002812_07 euxassay_002812_08 euxassay_002812_09 euxassay_002812_10
EMAGE:31876 EMAGE:31876 EMAGE:31876 EMAGE:31876 EMAGE:31876
euxassay_002812_11 euxassay_002812_12 euxassay_002812_13 euxassay_002812_14 euxassay_002812_15
EMAGE:31876 EMAGE:31876 EMAGE:31876 EMAGE:31876 EMAGE:31876
euxassay_002812_16 euxassay_002812_17 euxassay_002812_18 euxassay_002812_19 euxassay_002812_20
EMAGE:31876 EMAGE:31876 EMAGE:31876 EMAGE:31876
euxassay_002812_21 euxassay_002812_22 euxassay_002812_23 euxassay_002812_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 24
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 18 19 20
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 10 11 17 18
spinal cord
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 19 20
thoracic ganglion
weak weak
regionalweak expression: see section 14 15 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 09 10 11 12 13 14 17 18 19 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 22
not examined not examined
regionalnot examined expression: see section 01 02 03 24
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 16 17 18 19 20
cervical ganglion
weak weak
regionalweak expression: see section 09 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2126
Entity Detected:Ap3m2, adaptor-related protein complex 3, mu 2 subunit ( MGI:1929214)
Sequence:sense strand is shown

>T2126
CTTTNTCTTTCTTACTTGTCTAAAAGTAAAATGTCAGCCTGTTTCTTAGGTCCGTTCCCTCCGGGCTCCA
TCTACTCCCTTTTGTCCTCCGTCTTCAGCCACATAAGTGATGGAGGGAGAGAAAGTTCATTCGGGGAAAA
AACGAGGCCAACCCCAGCGCAGCACTGACTGAGTTCTGGAGGCGTGGCCTGGAGAGCAGCGGCCTGTGAC
ACTGCATTTCATCACTTTTAACACAGTTGCCGTGGGGAAAGACCGGCCTGTGATGTTTGGTTTCAGTCAC
CTAAACCCAATGGAAGATGTCTCTATTGATTTCTTTTTTTTTTAAGATAGAAAGATATGAGAGGGGAAAA
AAGAAGATCGGAAGAAAAATGGGTGTTAGTCCAAGAAAGAGCAGTTGAGATTTGACTCATGGGTCTGGGT
TGTACCTCGGTGATCAAGCCCTGACCTGGAGTCCTGGTTCATCCTGGGTACCACCCACAATGAAGACAGA
TCTGCTCGAT
Notes:The probe template was PCR amplified from IMAGE:864554 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:864554 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002812 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS