Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31878

Mtap6 ( MGI:1201690)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31878 EMAGE:31878 EMAGE:31878 EMAGE:31878 EMAGE:31878
euxassay_000634_01 euxassay_000634_02 euxassay_000634_03 euxassay_000634_04 euxassay_000634_05
EMAGE:31878 EMAGE:31878 EMAGE:31878 EMAGE:31878 EMAGE:31878
euxassay_000634_06 euxassay_000634_07 euxassay_000634_08 euxassay_000634_09 euxassay_000634_10
EMAGE:31878 EMAGE:31878 EMAGE:31878 EMAGE:31878 EMAGE:31878
euxassay_000634_11 euxassay_000634_12 euxassay_000634_13 euxassay_000634_14 euxassay_000634_15
EMAGE:31878 EMAGE:31878 EMAGE:31878 EMAGE:31878 EMAGE:31878
euxassay_000634_16 euxassay_000634_17 euxassay_000634_18 euxassay_000634_19 euxassay_000634_20
EMAGE:31878 EMAGE:31878 EMAGE:31878 EMAGE:31878
euxassay_000634_21 euxassay_000634_22 euxassay_000634_23 euxassay_000634_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 10 11 12 13 14 15
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 16 17 18 19 22
neural retina
moderate moderate
regionalmoderate expression: see section 01 20 21 22 23 24
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 12 13 15 16 17 18 19 20 22
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 06 07 08 11 12 16 17
inferior vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 11 13
vestibulocochlear viii ganglion vestibular component
moderate moderate
homogeneousmoderate expression: see section 02 03 15 16 17 22
superior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 03 15
vestibulocochlear viii ganglion cochlear component
moderate moderate
homogeneousmoderate expression: see section 02 03 15 16
inferior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 03 15
superior vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 04 05 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T788
Entity Detected:Mtap6, ( MGI:1201690)
Sequence:sense strand is shown

>T788
TCTCAGNCTGTTGGCCTACTGGGGACTCGGTGATGCGACAGGACTACCGCGCCTGGAAAGTGCAGCGGCC
CGAGCCAAGCTGCCGGCCGCGCAGCGAGTACCAGCCGTCCGACGCGCCCTTCGAGCGCGAGACCCAGTAC
CAGAAGGACTTCCGCGCCTGGCCGCTGCCCCGGCGCGGGGACCATCCCTGGATCCCCAAGCCGGTGCAAA
TCCCTGCGACTTCGCAGCCTTCCCAACCTGTTCTCGGGGTGCCCAAGCGTCGGCCTCAGAGCCAAGAGCG
CGGGCCCATGCAACTTTCTGCTGATGCCCGGGACCCGGAGGGTGCTGGAGGAGCCGGGGTGCTGGCGGCA
GGAAAGGCGTCCGGTGTAGACCAGCGCGACACACGTAGGAAGGCAGGGCCAGCATGGATGGTGACTCGCA
ACGAAGGGCACGAAGAGAAGCCTCTGCCCCCAGCCCAATCCCAGACCCAGGAGGGTGGTCCTGCAGCTGG
AAAGGCGTCCGGTGCAGATCAGCGTGACACACGCAGGAAGGCAGGGCCAG
Notes:The probe template was PCR amplified from IMAGE:1920612 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1920612 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000634 same experiment
 EMAGE:30185 same embryo
 EMAGE:30542 same embryo
 EMAGE:31872 same embryo
 EMAGE:31762 same embryo
 EMAGE:30541 same embryo
 EMAGE:31882 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS