Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31880

Osbpl3 oxysterol binding protein-like 3 ( MGI:1918970)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31880 EMAGE:31880 EMAGE:31880 EMAGE:31880 EMAGE:31880
euxassay_002818_01 euxassay_002818_02 euxassay_002818_03 euxassay_002818_04 euxassay_002818_05
EMAGE:31880 EMAGE:31880 EMAGE:31880 EMAGE:31880 EMAGE:31880
euxassay_002818_06 euxassay_002818_07 euxassay_002818_08 euxassay_002818_09 euxassay_002818_10
EMAGE:31880 EMAGE:31880 EMAGE:31880 EMAGE:31880 EMAGE:31880
euxassay_002818_11 euxassay_002818_12 euxassay_002818_13 euxassay_002818_14 euxassay_002818_15
EMAGE:31880 EMAGE:31880 EMAGE:31880
euxassay_002818_16 euxassay_002818_17 euxassay_002818_18

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 weak expression: see section 06
medulla oblongata basal plate
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 11
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 12 13 14 15 16 17 moderate expression: see section 18
vibrissa
weak weak
regionalweak expression: see section 05 06 16 17 18
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 10
kidney calyx
moderate moderate
regionalmoderate expression: see section 08 09 15 weak expression: see section 10 13 14
pons ventricular layer
strong strong
regionalstrong expression: see section 10
urethra of male
moderate moderate
regionalmoderate expression: see section 11
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T238
Entity Detected:Osbpl3, oxysterol binding protein-like 3 ( MGI:1918970)
Sequence:sense strand is shown

>T238
CCCGGAAGCAATTTGTCATTTTCTTGTGGTGGCGACACTCGAGTTCCTTTCTGGCTACAGTCTTCAGAGG
ACATGGAAAAATGTTCAAAAGACCTGGCACACTGCCATGCCTACCTGCTGGAAATGAGCCAGCTCTTAGA
AAGCATGGACGTCCTGCATCGGACATACTCGGCGCCAGCCATCAACGCCATCCAGGTCCCTAAGCCTTTT
TCTGGCCCTGTGAGACTGCACTCCTCCAATCCTAACTTGTCAACGCTGGACTTTGGAGAAGAGAAATCTT
ACTCGGATGGTTCTGAAGCCTCGTCAGAGTTCTCCAAGATGCAGGAGGATCTGTGCCATGTCGCCCACAA
AGTTTACTTCGCTTTAAGGTCGGCTTTCAATAGCATATCGGTGGAGAGAGAGAAACTGAAGCAGCTGATG
GAGCTGGACACCTCCCCCTCCCCCTCCGCTCAGGTCGTCGGGCTGAAGCACGCTCTGTCATCCGCCCTAG
CACAAAACACA
Notes:The probe template was PCR amplified from IMAGE:2650981 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2650981 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002818 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS