Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31882

St8sia1 ( MGI:106011)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31882 EMAGE:31882 EMAGE:31882 EMAGE:31882 EMAGE:31882
euxassay_000637_01 euxassay_000637_02 euxassay_000637_03 euxassay_000637_04 euxassay_000637_05
EMAGE:31882 EMAGE:31882 EMAGE:31882 EMAGE:31882 EMAGE:31882
euxassay_000637_06 euxassay_000637_07 euxassay_000637_08 euxassay_000637_09 euxassay_000637_10
EMAGE:31882 EMAGE:31882 EMAGE:31882 EMAGE:31882 EMAGE:31882
euxassay_000637_11 euxassay_000637_12 euxassay_000637_13 euxassay_000637_14 euxassay_000637_15
EMAGE:31882 EMAGE:31882 EMAGE:31882 EMAGE:31882 EMAGE:31882
euxassay_000637_16 euxassay_000637_17 euxassay_000637_18 euxassay_000637_19 euxassay_000637_20
EMAGE:31882 EMAGE:31882 EMAGE:31882 EMAGE:31882
euxassay_000637_21 euxassay_000637_22 euxassay_000637_23 euxassay_000637_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 15 16 17
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 07 08 16
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22
superior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 05 17
inferior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 05 06 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T784
Entity Detected:St8sia1, ( MGI:106011)
Sequence:sense strand is shown

>T784
TCCTCNAGNCTGTTGGCCTACTGGATCAGACGTCCGGGAGCCAGCCGCGCCTCTTCCAGGACCCCAGCCG
AGGGCGACGGTGATGCTGCAGTAAGGGCGGGAGCCACCGGCCCCACTGCTCTTAGACTCCTTCATCGCCC
GCTGCCTGCAGGGAAAGAGACTAAGGCTTGTGATTTGCCCGGAGGCCACTTCCTTTAGCAAGACATCCCA
GTAAAAGTTGCATTGGCGAAGATCCTTGTAGCTGACCTCTGGGGCCGTGGCGTGGGGGTTCCCCAGCCGT
GCGTTTGCGAGCTGGAAAGCCAAAGGTGTGTGTGCATGGGGGGCCGGCCACTGGAGCATCCTTCACTGCC
ACTTTGTCCAGCGTTGTGCTGAGGGTACACTGACCCTGGGACATCGAGGCTGCGATGAGCCCCTGCGGGC
GGGCCCTACATACGTCCAGAGGGGCCATGGCCATGCTAGCTCGGAAATTCCCGCGTACCCGGCTACCCGT
AGGAGCCAGTGCCCTCTGTGTGGTGGTCCTCTGTTGGCTCTACATCTTCCCTGTCTACCGGC
Notes:The probe template was PCR amplified from IMAGE:1908051 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1908051 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000637 same experiment
 EMAGE:31878 same embryo
 EMAGE:30185 same embryo
 EMAGE:30542 same embryo
 EMAGE:31872 same embryo
 EMAGE:31762 same embryo
 EMAGE:30541 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS