Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31885

Hook2 hook homolog 2 (Drosophila) ( MGI:2181664)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31885 EMAGE:31885 EMAGE:31885 EMAGE:31885 EMAGE:31885
euxassay_002815_01 euxassay_002815_02 euxassay_002815_03 euxassay_002815_04 euxassay_002815_05
EMAGE:31885 EMAGE:31885 EMAGE:31885 EMAGE:31885 EMAGE:31885
euxassay_002815_06 euxassay_002815_07 euxassay_002815_08 euxassay_002815_09 euxassay_002815_10
EMAGE:31885 EMAGE:31885 EMAGE:31885 EMAGE:31885 EMAGE:31885
euxassay_002815_11 euxassay_002815_12 euxassay_002815_13 euxassay_002815_14 euxassay_002815_15
EMAGE:31885 EMAGE:31885 EMAGE:31885 EMAGE:31885 EMAGE:31885
euxassay_002815_16 euxassay_002815_17 euxassay_002815_18 euxassay_002815_19 euxassay_002815_20
EMAGE:31885 EMAGE:31885 EMAGE:31885 EMAGE:31885
euxassay_002815_21 euxassay_002815_22 euxassay_002815_23 euxassay_002815_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
stomach
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 moderate expression: see section 03
kidney calyx
moderate moderate
regionalmoderate expression: see section 10 11 19 20 21 22
rectum
strong strong
regionalstrong expression: see section 16 17
male reproductive system
moderate moderate
regionalmoderate expression: see section 15 16
urethra of male
moderate moderate
regionalmoderate expression: see section 15 16 17
midgut
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
bladder
moderate moderate
regionalmoderate expression: see section 15 16
esophagus
strong strong
regionalstrong expression: see section 13 14
pancreas
moderate moderate
regionalmoderate expression: see section 11 12 13 17 weak expression: see section 18
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 20 21
trachea
moderate moderate
regionalmoderate expression: see section 13 14 15
vibrissa
moderate moderate
regionalmoderate expression: see section 08 24 weak expression: see section 06 07
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 18 19 21 22
hindgut
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 13 14 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 09 10 11 12
naris
moderate moderate
regionalmoderate expression: see section 14 15 16 18 19
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 13 14 18 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 14 18 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T433
Entity Detected:Hook2, hook homolog 2 (Drosophila) ( MGI:2181664)
Sequence:sense strand is shown

>T433
GTTTCACCCCCCTGTGCCAGTCCCCAGGACCTGAGCAGCGGACTCGCCATAGCCCATGTGCTGAATCAAA
TAGACCCTTCCTGGTTCAACGACGAATGGCTCCAGGGCATCTCAGAGGACTCAAGCCCCAGCTGGAGGTT
GAAGGTCAGGAAACTGGAGAAGATCTTACAGAGCTTGGTGGAATACTCGAAGAATGTTCTGGGGCACCCT
GTGTCAGATCAGCATCTCCCAGATGTGAGCCTCATTGGCGAGTTCTCAAATCCTGCAACTCGGCAAACTG
CTTCAGTTGGTACTGGGCTGTGCTATCAGTTGTGAGAAAAAACAGGAGTATATCCAAAGAATTATGACCC
TGGAGGAGTCTGTTCAACATGTAGTGATGGAAGCCATCCAGGAGCTCATGACCAAAGACGCTCCTGATTC
CCTGTCACCAGAGAATTACGGGAATTTTGATACACAGTCCCGCAGGTACTATTTCCTGAGTGAGGAGGTG
GAGGAG
Notes:The probe template was PCR amplified from IMAGE:3164670 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3164670 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002815 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS