Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31898

Crlf1 cytokine receptor-like factor 1 ( MGI:1340030)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31898 EMAGE:31898 EMAGE:31898 EMAGE:31898 EMAGE:31898
euxassay_008599_01 euxassay_008599_02 euxassay_008599_03 euxassay_008599_04 euxassay_008599_05
EMAGE:31898 EMAGE:31898 EMAGE:31898 EMAGE:31898 EMAGE:31898
euxassay_008599_06 euxassay_008599_07 euxassay_008599_08 euxassay_008599_09 euxassay_008599_10
EMAGE:31898 EMAGE:31898 EMAGE:31898 EMAGE:31898 EMAGE:31898
euxassay_008599_11 euxassay_008599_12 euxassay_008599_13 euxassay_008599_14 euxassay_008599_15
EMAGE:31898 EMAGE:31898 EMAGE:31898 EMAGE:31898 EMAGE:31898
euxassay_008599_16 euxassay_008599_17 euxassay_008599_18 euxassay_008599_19 euxassay_008599_20
EMAGE:31898 EMAGE:31898 EMAGE:31898
euxassay_008599_21 euxassay_008599_22 euxassay_008599_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
clavicle
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 13 16 17 18
axial skeleton
strong strong
regionalstrong expression: see section 13 14 15 16 moderate expression: see section 12
tongue muscle
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
foot
weak weak
regionalweak expression: see section 04 05 06 07 21 23
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 20
trachea
moderate moderate
regionalmoderate expression: see section 13 14
renal cortex
strong strong
regionalstrong expression: see section 18 19 21 moderate expression: see section 08 09 10 11 12 20
vibrissa
weak weak
regionalweak expression: see section 06 07 21
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 16 17 weak expression: see section 08 09 10 15 18 19 20
upper lip
moderate moderate
regionalmoderate expression: see section 06 07 12 13 14 15 16 18 19 20 21 weak expression: see section 08 09 10 11
naris
moderate moderate
regionalmoderate expression: see section 12 13 16 17 weak expression: see section 11 14 15 18
hand
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 23
glans of male genital tubercle
moderate moderate
regionalmoderate expression: see section 13 14 15 17 18 19 weak expression: see section 16
lung
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 moderate expression: see section 04
lower lip
moderate moderate
regionalmoderate expression: see section 06 07 12 13 14 15 16 17 18 19 20 21 weak expression: see section 08 09 10 11
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36199
Entity Detected:Crlf1, cytokine receptor-like factor 1 ( MGI:1340030)
Sequence:sense strand is shown

>T36199
TATACATGGAGACACACCTGGGGCCACCGCTGAGGGGCTCTACTGGACCCTCAATGGTCGCCGCCTGCCC
TCTGAGCTGTCCCGCCTCCTTAACACCTCCACCCTGGCCCTGGCCCTGGCTAACCTTAATGGGTCCAGGC
AGCAGTCAGGAGACAATCTGGTGTGTCACGCCCGAGACGGCAGCATTCTGGCTGGCTCCTGCCTCTATGT
TGGCTTGCCCCCTGAGAAGCCTTTTAACATCAGCTGCTGGTCCCGGAACATGAAGGATCTCACGTGCCGC
TGGACACCGGGTGCACACGGGGAGACATTCTTACATACCAACTACTCCCTCAAGTACAAGCTGAGGTGGT
ACGGTCAGGATAACACATGTGAGGAGTACCACACTGTGGGCCCTCACTCATGCCATATCCCCAAGGACCT
GGCCCTCTTCACTCCCTATGAGATCTGGGTGGAAGCCACCAATCGCCTAGGCTCAGCAAGATCTGATGTC
CTCACACTGGATGTCCTGGACGTGGTGACCACGGACCCCCCACCCGACGTGCACGTGAGCCGCGTTGGGG
GCCTGGAGGACCAGCTGAGTGTGCGCTGGGTCTCACCACCAGCTCTCAAGGATTTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100199. Forward Primer - name:100199_F_cDNA_Crlf1, sequence:TATACATGGAGACACACCTGGG; Reverse Primer - name:100199_N_SP6_cDNA_Crlf1, sequence:GAAATCCTTGAGAGCTGGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008599 same experiment
 EMAGE:30615 same embryo
 EMAGE:30460 same embryo
 EMAGE:30591 same embryo
 EMAGE:30597 same embryo
 EMAGE:30611 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS